Лавр антикокс: Sorry, this page can’t be found.

Содержание

Антикокс для двигателя LAVR 330 мл

  • Артикул: LN2504
  • Наличие: Есть в наличии

Антикокс для двигателя LAVR 330 мл

LAVR МL-202 Anti Coks Fast Раскоксовывание двигателя комплект 
Мы рады представить вашему вниманию новейший препарат серии «LAVR next». Технология раскоксовывания является передовой в области обслуживания и ремонта современных автотранспортных средств. Многочисленные стендовые и эксплуатационные испытания подтвердили реальную эффективность данного препарата. Уже сегодня мастера автосервисов и автомобилисты, используя наши технологии, получают хорошие результаты, и вот почему: 
Через двигатель проходят тонны топлива. Часть не сгоревшего топлива просачивается в зазор между поршнем и цилиндром. В свою очередь сгоревшее масло, всегда присутствующее на стенках цилиндра, снимается поршневыми кольцами. Эта смесь углеводородов неизбежно попадает в зазоры между кольцами и поршневыми канавками. Под действием высоких температур топливо и масло преобразуются в более вязкие и даже твердые трудно удаляемые смолисто-коксовые отложения. Вредные смолисто-коксовые отложения «прихватывают» поршневые кольца, нарушая их работоспособность. Как вы понимаете, это приводит к падению компрессии в цилиндрах, снижению мощности двигателя, плохому запуску, перерасходу топлива и масла, увеличению токсичности отработавших газов. Коксование также является причиной ускоренного износа цилиндро-поршневого комплекта. Проблема не нова, однако до недавнего времени она не имела оптимального решения. Использование традиционных растворителей даже при продолжительной обработке не давало желаемого результата и отрицательно влияло на детали двигателя. Именно поэтому специалистами нашей Компании был создан уникальный раскоксовывающий состав для быстрой очистки деталей внутрицилиндрового пространства. Препарат ML-202 представляет собой комплекс поверхностно-активных веществ и направленных растворителей разной химической природы, способный активно воздействовать на смолисто-коксовые и нагаровые отложения, образующиеся при эксплуатации поршневых двигателей. Жидкость для раскоксовывания ML-202 — средство «два в одном», т.к. не только очищает поршневые кольца и канавки, но и удаляет вредные отложения с поверхности деталей камеры сгорания, устраняя такие неприятные явления, как калильное зажигание и детонация. Препарат ML-202 прост в применении, поэтому раскоксовывание может провести любой водитель, обладающий элементарными навыками обслуживания двигателя. 
Комплектация: 
Бутылек с жидкостью ML-202 
Шприц 
Трубочка 
Подкапотная наклейка 
Результат применения: 
восстановление силового агрегата без разборки 
торможение процесса образования нагара 
Инструкция по применению: 
Упаковка с ML-202 содержит 330 мл раскоксовывающей жидкости, что достаточно для обработки четырехцилиндрового двигателя легкового автомобиля объемом от 2000 см3. 
Для дизельного двигателя того же объема необходимо 2 
Время обработки двигателя 1 час. 
Безвреден для деталей двигателя. 
 

Lavr ln2505 ПРИСАДКА для раскоксов.колец~0.185л+промывка двиг. 0.33л

Производитель: lavr
Артикул: ln2505
Найти цены
ПРИСАДКА для раскоксов.колец~0.185л+промывка двиг. 0.33л
Набор: Раскоксовывание двигателя ML-202 + Промывка двигателя (для двигателей до
Раскоксовыватель двигателя «LAVR» ML-202 (185 мл) (комплект + промывка двигателя
Набор: Раскоксовка LAVR МL-202 Anti Coks + Промывка двигателя Motor Flush (185мл
: LAVR L-202 Anti Coks + Motor Flush (185+330) Ln2505
Раскоксовка 185мл.+ промывка 230мл. для двигателя объёмом до 2 литров LAVR ML-20
LN2505_набор! для раскоксов. двигателя, ML-202 + промывка, для двиг до 2-х литро
Промывка двигателя + раскоксовка
LN2505 Набор: Раскоксовывание двигателя ML-202 + Промывка двигателя (для двигате
Набор:Раскоксовывание двигателя ML-202 +Промывка двигателя для двигателей до 2-х
Жидкость для раскоксов. LAVR Ln2505 Набор: Раскоксовывание LAVR ML-202 Anti Cocs
Набор: Раскоксовывание двигателя ML-202 + Промывка двигателя (для двигателей до
Набор Lavr раскоксовка МL202 + промывка двигателя 185/330 мл
НАБОР: РАСКОКСОВЫВАНИЕ LAVR МL-202 ANTI COKS + ПРО
Жидкость для раскоксов. LAVR Ln2505 ML-202 Anti Cocs+Промывка двигателя Motor Fl
Набор для раскоксовывания двигателя раскоксовка + промывка (для двигателей объём
Жидкость для раскоксовывания двигателя
РАСКОКСОВКА ДВИГАТЕЛЯ ML-202, 185мл + ПРОМЫВКА 330мл /LAVR/
LAVR 2505 Раскоксовка ЛАВР 185 мл. + промывка 330 мл. Ln2505
Антикокс, раскоксовывание двигателя LAVR + 5-мин. промывка двигателя 185мл/330мл
Набор: Раскоксовка МL-202 185мл Anti Coks + Промывка двигателя 330мл
Автодеталь
Раскоксовывание ML202+5-минутная промывка двигателя, 185мл/330мл «LAVR»
Антикокс LAVR 185мл + промывка двигателя, набор
Раскоксовка,двигателя+промывка(185мл+330мл),
Раскоксовка двигателя двухкомпонентная 185+330 mlLN2505
НАБОР РАСКОКСОВЫВАНИЕ ДВИГАТЕЛЯ ML-202 + ПРОМЫВКА ДВИГАТЕЛЯ (ДЛЯ ДВИГАТЕЛЕЙ ДО
Набор: Раскоксовывание LAVR МL-202 Anti Coks + Промывка двигателя
Раскоксовыватель колец Лавр
Набор Раскоксовывание двигателя ML-202 + Промывка двигателя (для двигателей до
Фото:
Информация: Здесь Вы можете найти описание, варианты наименования, цены и аналоги для ln2505 lavr — ПРИСАДКА для раскоксов.колец~0.185л+промывка двиг. 0.33л. Для поиска цен и предложений нажмите кнопку «Найти цены».

Антикокс (препарат для раскоксовывания двигателя) ML-203 Novator 190 мл LAVR, Ln2506

Раскоксовыватель двигателя ML-203 Лавр

Препарат ml 203 Лавр используется для раскоксовки двигателя на четыре цилиндра. Состав отлично отрабатывает по бензиновым и дизельным силовым установкам коммерческого и легкового транспорта.

Преимущества продукта Мл-203

Жидкость для раскоксовки удаляет отложения смолы, кокса всего за 60 минут. Мы говорим об очистке поршня, колец, деталей камеры сгорания. Обработанные этим веществом моторы, восстанавливают компрессию цилиндров в рабочих рамках. Повышают технические характеристики силовых агрегатов, снижают показатели расхода горючего и смазочных веществ. Раскоксовка ml 203 облегчает запуск ДСВ на холоде.

Комплектация и особенности

В состав препарата ml 203 Лавр входит:

  1. Инструкция от производителя.
  2. Жидкость.
  3. Удлинительная трубка.
  4. Шприц для подачи жидкости.
  5. Подкапотная наклейка.

Обратите внимание! Производитель рекомендует проводить очистку силового агрегата каждые 20-25 тыс. км пробега авто во время прохождения планового обслуживания. Допускается сокращение сроков чистки моторной установки до 10-15 тыс. км пробега при эксплуатации в тяжёлых условиях.

Инструкция пользования

Алгоритм действий следующий:

  1. Мотор прогревается до t0700С.
  2. Отключается система зажигания: на бензиновых агрегатах демонтируются свечи зажигания. На дизельных установках снимаются свечи накаливания.
  3. Поршни выставляются в среднем положении.
  4. Используя трубку и шприц, заливается жидкость в отдельно взятый цилиндр.
  5. Время профилактического действия жидкости составляет 30 мину. Нельзя удерживать вещество в середине агрегата более чем 1,5 часа.
  6. Остатки вещества удаляются воздухом.
  7. На свои места устанавливаются демонтированные ранее детали.

Работа двигателя проверяется на холостых оборотах. Контрольное время 5-10 минут.

В заключение о раскоксовке Лавр

Использование жидкости ml 203, предполагает неукоснительное соблюдение инструкций, использование препарата по назначению в отведенные для этого сроки.

 

 

Дифференциальная компенсация двух циклооксигеназ в почечном гомеостазе не зависит от простагландин-синтетической способности в базовых условиях

FASEB J. 2018 Oct; 32 (10): 5326–5337.

Синьчжи Ли

* Департамент биомедицинских и молекулярных наук, Королевский университет, Кингстон, Онтарио, Канада; и

Людмила Л. Мазалеуская

Институт трансляционной медицины и терапии, Медицинская школа Перельмана, Университет Пенсильвании, Филадельфия, Пенсильвания, США

Лорел Л.Ballantyne

* Департамент биомедицинских и молекулярных наук, Королевский университет, Кингстон, Онтарио, Канада; и

Hu Meng

Институт трансляционной медицины и терапии, Медицинский факультет Перельмана, Университет Пенсильвании, Филадельфия, Пенсильвания, США

Гаррет А. Фитцджеральд

Институт трансляционной медицины и терапии, Перельман Медицинский факультет Пенсильванского университета, Филадельфия, Пенсильвания, США

Колин Д.Funk

* Департамент биомедицинских и молекулярных наук, Королевский университет, Кингстон, Онтарио, Канада; и

* Департамент биомедицинских и молекулярных наук Королевского университета, Кингстон, Онтарио, Канада; и

Институт трансляционной медицины и терапии Медицинской школы Перельмана, Университет Пенсильвании, Филадельфия, Пенсильвания, США

1 Для корреспонденции: Департамент биомедицинских и молекулярных наук, 433 Botterell Hall, 18 Stuart St., Королевский университет, Кингстон, ON K7L 3N6, Канада. Электронная почта: [email protected]

Поступила в редакцию 6 февраля 2018 г .; Принято 9 апреля 2018 г.

Эта статья цитируется в других статьях в PMC.

Abstract

Различные функции каждой изоформы циклооксигеназы (ЦОГ) в почечном гомеостазе были предметом интенсивных исследований в течение многих лет. Мы применили новый подход с использованием 3 охарактеризованных линий мышей, в которых гены простагландин (PG) -эндопероксидсинтазы 1 и 2 ( Ptgs1 и Ptgs2 ) заменяют друг друга, чтобы обозначить различные роли и возможность замещения изоформ ЦОГ.Перевернутые гены Ptgs генерируют обратный паттерн экспрессии СОХ в почках, где ноккин СОХ-2 экспрессируется в высокой степени. Нормальный нефрогенез сохранялся у всех 3 штаммов на постнатальной стадии d 8 (P8). Knockin COX-1 может временно восстановить функцию почек и отсрочить, но не предотвратить почечную патологию, являющуюся следствием делеции COX-2. Потеря ЦОГ-2 у взрослых мышей ЦОГ-1> ЦОГ-2 приводит к тяжелой нефропатии, которая приводит к нарушению функции почек. Эти дефекты частично устраняются за счет нокина COX-2 у мышей Reversa, тогда как COX-2 может компенсировать потерю COX-1 у мышей COX-2> COX-1.Интересно, что высокоэкспрессируемый фермент knockin COX-2 практически не производит каких-либо PG или тромбоксана у новорожденных P8 или взрослых мышей, демонстрируя, что для биосинтеза простаноидов требуется нативный COX-1 и он не может быть восстановлен с помощью knockin COX-2. Таким образом, 2 изоформы ЦОГ могут преимущественно компенсировать некоторые функции почек, которые, по-видимому, не зависят от способности синтезировать PG. — Ли, X., Мазалеуская, Л.Л., Баллантайн, Л.Л., Менг, Х., Фитцджеральд, Джорджия, Funk, CD Дифференциальная компенсация двух циклооксигеназ в почечном гомеостазе не зависит от простагландин-синтетической способности в основных условиях.

Ключевые слова: эйкозаноид, нацеливание на гены, развитие почек, функция почек

Простагландин (PG) H-синтаза, более известная как циклооксигеназа (COX), существует в виде 2 изоформ, COX-1 и COX-2, кодируемых генами PG -эндопероксидсинтазы 1 и 2 ( Ptgs1 и Ptgs2 соответственно). ЦОГ катализирует первые 2 стадии биосинтеза семейства биоактивных липидных медиаторов, PG и тромбоксана (Tx), вместе называемых простаноидами, из субстрата арахидоновой кислоты (AA).PG, производные от COX, выполняют сложные и разнообразные функции по регулированию сосудистого тонуса, гомеостаза жидкости и системного кровяного давления в почках. Обе изоформы ЦОГ экспрессируются в почках млекопитающих, но они демонстрируют различные паттерны экспрессии в почках (1). ЦОГ-1 преобладает в собирающих мозговых каналах и интерстициальных клетках, тогда как ЦОГ-2 экспрессируется в плотном пятне юкстагломерулярного аппарата и связанной с ним толстой восходящей кортикальной конечности Генле и в интерстициальных клетках продолговатого мозга (2–4).ЦОГ-2 конститутивно экспрессируется в почках на низких уровнях, но сохраняет свои индуцируемые свойства и легко регулируется различными стимулами (5). ЦОГ-1 и ЦОГ-2 обладают различными биохимическими свойствами в превращении АК в простаноиды в результате их дифференциальных регуляторных механизмов, тканевого распределения и доступности последующих простаноид-синтаз. Таким образом, 2 почечные изоформы ЦОГ вносят различный вклад в продукцию простаноидов в почках (6–8).

Фармакологическое (9–11) и генетическое (12–14) ингибирование путей ЦОГ / ПГ дало данные для объяснения специфических для изоформ ЦОГ функций в почках.Дефицит ЦОГ-2 у мышей был тесно связан с проблемами постнатального развития почек, которые могут прогрессировать до тяжелых аномалий у взрослых мышей (12, 14). Напротив, нарушение ЦОГ-1 не приводило к дефектам почек (13), но вызывало натрийурез и снижение артериального давления у животных, получавших диету с низким содержанием соли (15). Дальнейшие исследования показали, что связанное с ЦОГ-2 почечное архитектурное нарушение и функциональное ухудшение начинаются в заключительных фазах нефрогенеза к 10-му постнатальному дню (16) и зависят от дозы гена (17, 18) и рецептора ангиотензина II (19). .Интересно, что в одном из наших предыдущих исследований, где ЦОГ-1 находился под регуляторным контролем ЦОГ-2 (ЦОГ-1> ЦОГ-2), ЦОГ-1 мог частично компенсировать ЦОГ-2, чтобы спасти развитие почек и функцию почек, по крайней мере, у молодых мышей (<2 мес.) (20) и у мышей, получавших нормальную натриевую диету (21). Однако хроническая почечная патология была обнаружена у старых мышей COX-1> COX-2 (6 мес.) С истонченной кортикальной мантией (20).

Догма о том, что ЦОГ-1 поддерживает функцию почек, была фундаментально оспорена в нескольких исследованиях с использованием конкретных мышей с дефицитом ЦОГ-1 или ЦОГ-2 (4, 12–14, 16).Исследования на животных и людях подтверждают важность ЦОГ-2 для почечного гомеостаза. Однако остается ряд вопросов о функции ЦОГ-1 и ЦОГ-2 и их последующих ферментативных метаболитов. Например, нокаут ЦОГ-2 не снижал продукцию PG в мозговом веществе почек и даже немного увеличивал ее в коре почек (7), но в конечном итоге приводил к тяжелым почечным дефектам. Напротив, нокаут ЦОГ-1 приводил к гораздо меньшей продукции PG как в мозговом веществе, так и в коре головного мозга (7) без очевидного почечного фенотипа (13).Что может быть основной причиной такого несоответствия профилей PG почек и почечных структурных дефектов и дефектов развития? Здесь мы использовали линии мышей COX-1> COX-2 (20), COX-2> COX-1 и Reversa (22, 23) для изучения различных ролей изоформ 2 COX в почках. Мы предположили, что изоформы 2 ЦОГ могут преимущественно компенсировать некоторые функции почек и, в свою очередь, по-разному поддерживать гомеостаз в базовых условиях. Мы сосредоточились на основном физиологическом значении для почек 2 изоформ ЦОГ, чтобы изучить функциональные последствия обмена ЦОГ-1 и ЦОГ-2 и определить роль простаноидов, производных ЦОГ.

МАТЕРИАЛЫ И МЕТОДЫ

Мыши

Штамм мышей COX-1> COX-2 (COX-1> 2) на смешанном генетическом фоне C57BL / 6 × 129 / Sv был установлен ранее путем замены большинства экзонов 1–9 из Ptgs2 с полной кДНК Ptgs1 (20). Впоследствии этих мышей подвергали обратному скрещиванию со штаммом C57BL / 6 в течение 10 поколений. Штамм мышей COX-2> COX-1 (COX-2> 1) на фоне C57BL / 6 был установлен путем частичной замены кодирующей области Ptgs1 (экзоны 3–10) на Ptgs2 экзонов 2–10 , оставляя интактной промоторную область Ptgs1 (23).Скрещивание мышей COX-1> COX-2 и COX-2> COX-1 дает мышей Reversa (22, 23). Генотипирование обычно выполняли с помощью ПЦР на ДНК, выделенной из биоптатов хвоста. Следует отметить, что эндогенные аллели Ptgs все еще присутствуют в геноме одной нокиновой мыши; , то есть , эндогенный Ptgs2 находится у COX-2> 1 мышей и эндогенный Ptgs1 у COX-1> 2 мышей. Все процедуры экспериментов на животных проводились в соответствии с принципами и руководящими указаниями Канадского совета по уходу за животными и были одобрены Комитетом по уходу за животными Королевского университета.

Биохимические анализы крови и мочи

Цельную кровь отбирали из поднижнечелюстной вены в пробирки для сбора крови с литиевым гепарином (BD Medical, Франклин Лейкс, Нью-Джерси, США) и хранили на льду. Мы использовали комплексную диагностику VetScan VS2 (Abaxis, Юнион-Сити, Калифорния, США) для анализа образцов. В некоторых экспериментах кровь, антикоагулированная гепарином, была взята из подчелюстной вены; центрифугировали при 3000 g , 10 мин при 4 ° C; и анализировали на уровни азота мочевины крови (BUN) с использованием тест-полосок Reflovet BUN (Roche, Mannheim, Germany).Образцы мочи мышей собирали и хранили при -80 ° C до измерения электролитов, как это обычно выполняется в Core Laboratory Services, Kingston General Hospital (Kingston, ON, Canada) (18). Концентрацию белка в моче определяли методом Брэдфорда.

Гистопатология почек

После эвтаназии с помощью CO 2 асфиксии почки мышей на Р8 или взрослых мышей (3,5 и 7 мес.) 4 генотипов с примерно равным количеством самцов / самок вскрыли, взвесили и осторожно разрезали. по продольной оси.Почки фиксировали в 10% забуференном формалине в течение 24 часов, обрабатывали в обычном порядке и заливали парафином для окрашивания гематоксилином и эозином или периодической кислотой-Шиффом (PAS; MilliporeSigma, Сент-Луис, Миссури, США) для оценки. Для количественного анализа срезы почек были сняты с помощью системы OpenLab Imaging (Improvision, Lexington, MA, USA) на инвертированном микроскопе (DM IRB; Leica Microsystems, Richmond Hill, ON, Canada) и количественно определены с помощью программного обеспечения Image-Pro Plus (Media Cybernetics, Силвер-Спринг, Мэриленд, США).Было проанализировано не менее 3 срезов почек от 6 до 7 отдельных животных из каждой группы. Для каждого среза были случайным образом выбраны 7–10 клубочков, которые были визуализированы в цифровом виде. Клубочки, которые казались разрезанными по касательной, были исключены из группы наблюдения. Диаметр клубочков в поперечном сечении измеряли перпендикулярно почечной капсуле. Толщина субкапсулярной коры определялась по расстоянию от капсулы Боумена ближайшего клубочка до кортикального края. Кроме того, отдельно регистрировали диаметры юкстамедуллярных клубочков, расположенных близко к медуллярной границе.Все образцы были проанализированы исследователем, не знакомым с планом исследования.

Вестерн-блот-анализ и иммуногистохимия

Тканевые лизаты всей почки или рассеченной почки (кора и продолговатый мозг) получали с реагентом экстракта белка T-PER (Thermo Fisher Scientific, Уолтем, Массачусетс, США) плюс коктейль ингибиторов протеаз ( Roche Diagnostics, Индианаполис, Индиана, США). Вестерн-блоттинг выполняли, как описано ранее (22, 23).

Во время иммуногистохимического окрашивания срезы ткани, залитые парафином, депарафинизировали, регидратировали и подвергали поиску антигена.После пермеабилизации и предварительной инкубации в козьей сыворотке и растворе, блокирующем пероксидазу, срезы инкубировали в течение ночи при 4 ° C с кроличьими поликлональными антителами против COX-1 (Cayman Chemical, Ann Arbor, MI, USA) или кроличьими поликлональными антителами против COX. -2 (Cayman Chemical) в разведении 1: 100. Отрицательные контроли инкубировали в течение ночи в PBS. После промывания срезы инкубировали с козьим вторичным антителом против кроличьей пероксидазы хрена (A9169; MilliporeSigma) в разведении 1: 400.Иммуногистохимическая реакция была проведена с использованием набора субстратов Immpact 3,3′-диаминобензидинпероксидазы (SK-4105; Vector Laboratories, Burlingame, CA, USA).

Антитела, используемые для вестерн-блоттинга и иммуногистохимических исследований, были специфичными для каждой изоформы. Антитело против COX-1 было продуцировано против COX-1 мыши aa 274–288 LMRYPPGVPPERQMA в средней области нативного COX-1; анти-ЦОГ-2 был против ЦОГ-2 мыши 584–598 SHSRLDDINPTVLIK на нативном С-конце ЦОГ-2.Ранее мы описали, что не смогли разработать стратегию различения нокина и эндогенных (нативных) белков (23). Таким образом, белки, обнаруженные с помощью вестерн-блоттинга или иммуногистохимии, состояли как из эндогенного, так и из нокаинового ЦОГ. Однако у мышей Reversa отсутствуют обе нативные изоформы ЦОГ, и любая обнаруженная экспрессия белка ЦОГ является исключительно результатом нокатинных белков ЦОГ. Более того, уровень экспрессии белка изоформы ЦОГ нельзя было сравнивать напрямую из-за различий в аффинности между эпитопами, используемыми для генерации соответствующих антител ЦОГ-1 и ЦОГ-2.

Количественная ПЦР в реальном времени

Суммарную РНК экстрагировали из рассеченного мозгового вещества и коры головного мозга взрослой почки или целой почки в точке P8 с использованием наборов для очистки РНК GeneJet (Thermo Fisher Scientific, Вильнюс, Литва). После обработки ДНКазой I количество РНК оценивали с помощью спектрофотометра Nanodrop N-1000 (Nanodrop, Wilmington, DE, USA), а затем проверяли качество выделенной РНК с помощью реагентов Agilent RNA 6000 Nano Assay Kit с использованием биоанализатора Agilent 2100. (Agilent Technologies, Санта-Клара, Калифорния, США).Синтез кДНК и количественная ПЦР в реальном времени (КПЦР) были выполнены, как описано ранее (23). Олигонуклеотидные праймеры перечислены в.

ТАБЛИЦА 1

Праймеры, используемые в реакциях кПЦР в реальном времени

ACGACATGGAGACAATCTATCCT TGAGGACAACGAGGAAATGT Hpgds TGGCCTAAAATCAAGCCAAC CCACTGCATCAGCTTGACAT Lpgds
Праймер, 5’– 3 ‘
Ген Белок Обратный 901 GAPDH GAPDH CATGGCCTTCCGTGTTCCTA ATGCCTGCTTCACCACCTTCT
Ptgis PGIs ACAGCATCAAACAATTTGTCGTC GCATCAGACCGAAGCCATATCT
Ptges mPGES-1
H-PGDS
L-PGDS GGTTCCGGGAGAAGAAAGCT CACTGACACGGAGTGGATGC
Tbxas1 TBXAS1 TACCATAGTGACTGTGACTCTGC GGTGCCTGATGCCCAACTT
Akr1b3 AKR1B3 (PGFS) TCGTGGTGACAGCATATAGTCC CCAGGAGAGACGGATCTTCA
Рен ренин ATGAAGGGGGTGTCTGTGGGGTC ATGTCGGGGAGGGTGGGCACCTG
Hpgd HPGD ATAATGATGCCGCCTTCACCT TCTGTTCATCCAGTGCGATGT

почки эйкозаноидов синтетический потенциал

Для определения синтеза эйкозаноидов в присутствии / отсутствии экзогенного АК, либо вся почка, либо рассеченный мозговое вещество почек взвешивали и быстро гомогенизировали. в 4 об. (мас. / об.) буфере для холодной ткани [50 мМ Трис (pH 7.4), 1 мМ фенола и 1 × коктейль ингибиторов протеазы (Roche)] с последующей обработкой ультразвуком (5–10 раз в течение 2–4 с на льду). Гомогенаты центрифугировали 10 мин при 3000 g при 4 ° C и определяли концентрацию белка в супернатантах. Образцы (100 мкг белка) нагревали при 37 ° C в течение 1 мин, и реакции начинали добавлением носителя (0,25% этанол; -AA) или AA (50 мкМ; + AA). После 10 мин инкубации реакцию останавливали 1% муравьиной кислотой.

Анализ эйкозаноидов

Использовался ранее описанный протокол (22, 23).Анализ выполняли на сверхэффективной жидкостной хроматографической системе Waters Acquity, совмещенной с трехквадрупольным масс-спектрометром Waters Xevo TQ-S. Ультраэффективная система жидкостной хроматографии напрямую взаимодействует с источником ионизации электрораспылением в отрицательном режиме масс-спектрометра, используя мониторинг множественных реакций. Данные были нормализованы по содержанию белка в препарате почек.

Анализ данных

Данные выражены как среднее ± средн. Тест Колмогорова-Смирнова использовался в качестве теста на нормальность.Для нормально распределенных переменных использовали односторонний ANOVA-анализ, и сравнения Dunnett T3 post hoc проводили, когда ANOVA указывал на значительную разницу между сравниваемыми средними. Непараметрические критерии Краскела-Уоллиса использовались для переменных с ненормально распределенными значениями. Тесты были двусторонними, и значения P <0,05 считались статистически значимыми. Статистический анализ выполняли с помощью GraphPad Prism 7 (GraphPad Software, Сан-Диего, Калифорния, США).

РЕЗУЛЬТАТЫ

Распределение ЦОГ-1 и ЦОГ-2 в коре и мозговом веществе почек мышей с ноккином

Распределение 2 изоформ ЦОГ в почках изучали с помощью Вестерн-блот-анализа и иммуногистохимической локализации ().Согласно анализу вестерн-блоттинга () нативный ЦОГ-1 (70 кДа) полностью нокаутирован во всех протестированных тканях ЦОГ-2> 1 и Reversa, как в мозговом веществе почек, так и в коре головного мозга, как и ожидалось. Выявлена ​​экспрессия COX-2 (72 кДа) как у COX-2> 1, так и у мышей Reversa в основных условиях. Более того, уровень экспрессии knockin COX-2 выше в мозговом веществе, чем в коре, что отражает распределение экспрессии эндогенного COX-1 в этих тканях. В базовых условиях ноккин СОХ-1 у мышей Reversa, регулируемый промотором Ptgs2 , не обнаруживается с помощью Вестерн-блоттинга.У мышей дикого типа (WT) не было обнаружено ни медуллярной, ни кортикальной базальной иммуноблоттинговой реактивности COX-2, несмотря на ее обнаружение, как и ожидалось, в тканях knockin.

Экспрессия изоформ ЦОГ в коре и мозговом веществе почек у мышей WT и Reversa. A ) Вестерн-блот-анализ изоформ ЦОГ в коре и мозговом веществе почек 4 линий мышей (возраст 3,5 мес.). Изображения представляют 3 отдельных эксперимента. B ) Изображения, демонстрирующие иммуноокрашенную 3,3′-диаминобензидином кору, внешний и внутренний мозговые вещества мышей WT и Reversa.Шкала 100 мкм.

Результаты иммуногистохимии хорошо согласуются с результатами вестерн-блоттинга (). В почке WT ЦОГ-1 экспрессируется в больших количествах в проксимальных извитых канальцах (коре), а также в наружных и внутренних собирающих мозговых каналах, тогда как ЦОГ-2 слабо проявляется в плотном пятне (коре) и некоторых интерстициальных клетках в продолговатом мозге. как сообщалось ранее (2, 3, 8). В тканях Reversa, в которых обе нативные изоформы разрушены, обнаруженные белки происходят из замененных генов.Экспрессия СОХ-1 практически не наблюдалась в почках мышей Reversa в основных условиях. Напротив, конститутивно экспрессируемый ЦОГ-2 наблюдался в коре и мозговом веществе Reversa, хотя уровень экспрессии был намного ниже, чем уровень экспрессии нативного ЦОГ-1 в почках дикого типа. При успешных подходах к нокину экспрессия СОХ-1 и СОХ-2 не определялась во всех областях в СОХ-2> 1 и СОХ-1> 2, соответственно (дополнительный рисунок S1). Как описано ранее, мы не смогли различить нокин и эндогенные (нативные) белки в почках COX-2> 1 или COX-1> 2, поскольку антитела реагируют с общими эпитопами.Следовательно, экспрессия ЦОГ-2 в почке ЦОГ-2> 1 с дополнительным вкладом белка нокина, запускаемого Ptgs1 , оказалась выше, чем у WT, и уровень экспрессии ЦОГ-1 в почке ЦОГ-1> 2 был немного ниже. выше, чем у WT (дополнительный рис. S1).

Влияние обмена ЦОГ на биохимические профили почек

Хорошо известно, что потеря ЦОГ-2 у мышей приводит к нарушению постнатального развития почек и впоследствии к почечной недостаточности (12, 14). Мы определили влияние обмена ЦОГ на функцию почек у взрослых мышей в возрасте 3–4 мес. ().Никаких идентифицируемых изменений не было обнаружено в почечных индексах мышей COX-2> 1, показывающих почечный фенотип, аналогичный почечному фенотипу мышей без COX-1 (13). В отличие от мышей COX-2> 1, мыши COX-1> 2, напоминающие мышей с дефицитом COX-2 (12, 14), демонстрировали дефекты почек, которые ухудшались с возрастом (20, 24). Уровни АМК в цельной крови были повышены у мышей COX-1> 2 по сравнению с мышами WT (33,0 ± 2,1 против 24,4 ± 1,1 мг / дл, P <0,05). У мышей Reversa этого не наблюдалось. Однако у мышей COX-1> 2 и Reversa наблюдалось нарушение натрийуреза, измеряемое по уменьшению экскреции натрия с мочой ().Этот результат был аналогичен результату, полученному у мышей без COX-2, у которых базальный объем мочи и базальная экскреция натрия с мочой были значительно снижены (8). Обмен ЦОГ не повлиял на гомеостаз электролитов крови, при этом электролиты натрия, калия, кальция, хлорида и фосфора не изменились. Эти данные соответствуют предыдущему исследованию мышей с нокаутом по ЦОГ-2 (16). По сравнению с мышами WT различий в экскреции белка с мочой не наблюдалось. В совокупности потеря ЦОГ-2 приводит к нарушению функции почек, которое частично компенсируется нокином ЦОГ-2 у мышей Reversa.Обмен генов в настоящем исследовании выявляет различные роли этих 2 изоформ ЦОГ и дифференциальную компенсацию в почечном гомеостазе.

ТАБЛИЦА 2

Профиль биохимии почек в цельной крови и моче

Кровь (мг / дл)
WT COX-2> 1 COX-1> 2 Reversa 139

АМКУК (мг / дл) 24.4 ± 1,1 22,3 ± 1,3 33,0 ± 2,1 * 27,3 ± 1,7
Ca 2+ (мг / дл) 11,1 ± 0,3 11,0 ± 0,2 10,9 ± 0,2 10,3 ± 0,1
Na + (мМ) 149,4 ± 1,0 149,4 ± 0,9 148,7 ± 0,9 147,6 ± 0,7
K 9000 м7 + 9000 м7 ± 0,2 8,4 ± 0,1 8.1 ± 0,3 8,3 ± 0,1
Cl (мМ) 112,5 ± 0,7 110,6 ± 0,9 113,8 ± 0,9 113,3 ± 1,7
Фосфор 7,9 ± 0,6 7,8 ± 0,6 7,1 ± 0,8 7,0 ± 0,5
Моча
Na + (мМ) 1615,8 149.6 ± 14,6 116,7 ± 15,7 * 116,6 ± 9,1 *
Белок (мг / мл) 0,95 ± 0,14 1,02 ± 0,05 1,10 ± 0,06

Влияние обмена ЦОГ на почечную патологию

В почках мышей ЦОГ-2> 1 по сравнению с мышами WT не наблюдалось заметных патологических отклонений, что согласуется с предыдущим выводом о том, что нарушение ЦОГ-1 не приводит к дефектам почек. (13).Наши предыдущие данные показали, что нокин ЦОГ-1 может восстанавливать функцию почек у молодых (2 мес.), Но не у старых мышей (> 6 мес.) (20). В текущем исследовании нефропатия в почках взрослых COX-1> 2 характеризуется аномальной почечной корой, состоящей из небольших незрелых клубочков и канальцев, состояние которых прогрессивно ухудшается с возрастом (от 3,5 до 7 мес.). Изменения у мышей Reversa также заключались в умеренной потере кортикальной мантии и умеренной дисплазии клубочков в поверхностной почечной коре (2).В возрасте 3,5 мес. Средний диаметр поперечного сечения клубочков у всех трех мутантных генотипов не изменился по сравнению с мышами WT. Напротив, средний диаметр клубочков у 7-месячных мышей COX-1> 2 и Reversa был снижен из-за нарушения развития коркового вещества почек (2). Однако у мышей Reversa наблюдалась тенденция к увеличению толщины коры по сравнению с мышами COX-1> 2 (), что позволяет предположить, что дефекты развития клубочков были частично устранены у мышей Reversa за счет обмена COX.

Анализ патологии почек при различных генотипах нокина ЦОГ. A ) Типичные световые микрофотографии (окрашивание PAS) почек мышей WT, COX-2> 1, COX-1> 2 и Reversa (3,5 мес., Слева; 7 мес., Справа). Оригинальное увеличение, × 200; масштабные линейки, 100 мкм. B ) Средний диаметр кортикальных клубочков. C ) Толщина субкапсулярной коры у 4 групп мышей. Данные представлены в виде средних значений ± sem, n = 6–8. * P <0,05 vs. Вт.

Кроме того, было обнаружено, что клубочки за пределами гипопластической зоны (, например, , юкстамедуллярные клубочки, у мышей COX-1> 2, значительно увеличены из-за повышенной клеточности клубочков) () в результате воспалительных клеток инфильтрация (20) и компенсаторная гипертрофия (14). Уровни BUN в плазме у мышей COX-1> 2 были повышены в 1,6 раза по сравнению с мышами WT через 3,5 или 7 месяцев. В то же время уровни BUN у мышей Reversa были немного увеличены по сравнению с контрольными мышами WT, но были значительно снижены по сравнению с мышами COX-1> 2 (), что указывает на то, что частичное восстановление функции почек может быть установлено путем обмена COX. , особенно в случае замены ЦОГ-2 на ЦОГ-1.По сравнению с мышами с полным нокаутом ЦОГ-2 с уровнем АМК 80–100 мг / дл (20, 24) у взрослых мышей ЦОГ-1> 2 наблюдались легкие признаки почечной дисфункции, измеренные с помощью АМК (38,4 ± 2,5 мг / дл. ). Это соответствует промежуточному фенотипу почек в модели нокдауна гена ЦОГ-2 (18), что указывает на то, что ЦОГ-1 может до некоторой степени компенсировать потерю ЦОГ-2 для поддержания почечного гомеостаза, несмотря на анатомические особенности почек. аномалии. Однако ЦОГ-2 может компенсировать потерю ЦОГ-1 во всех измеренных здесь аспектах почечной функции.

Нарушение функции почек при разных генотипах нокина ЦОГ. A ) Типичные световые микрофотографии (окраска PAS) юкстамедуллярных клубочков от мышей WT, COX-2> 1, COX-1> 2 и Reversa (3,5 мес., Слева; 7 мес., Справа). Оригинальное увеличение, × 400; масштабная линейка, 100 мкм. B ) Средний диаметр юкстамедуллярных клубочков. C ) Концентрация BUN в плазме. Плазму собирали из крови, антикоагулированной гепарином, и анализировали с помощью тест-полосок BUN. Данные представлены в виде средних значений ± sem, n = 6–8.* P <0,05 по сравнению с WT.

Синтез эйкозаноидов в почках взрослых мышей, нокаутированных по ЦОГ

Способность почек вырабатывать простаноиды первоначально оценивалась в гомогенатах цельной почки в отсутствие или в присутствии АК (). Наши данные показали, что способность к синтезу простаноидов была выше для ЦОГ-1, как в присутствии, так и в отсутствие природного ЦОГ-2. Наши результаты напоминают предыдущие результаты у мышей с нокаутом гена COX-1> 2, где COX-1 в первую очередь способствует производству базальных простаноидов в почках (7).Нарушение нативного СОХ-1 у мышей СОХ-2> 1 и Reversa привело к подавленной способности продуцировать все обнаруженные простаноиды, что также наблюдалось в отсутствие экзогенного АК.

Способность почек вырабатывать PG у мышей в возрасте 3,5 мес. Определение синтеза ПГ в отсутствие или в присутствии экзогенной АК. Гомогенаты целых почек (100 мкг белка) инкубировали с 0,25% этанолом (-AA) или 50 мкМ AA (+ AA) в течение 10 минут и измеряли PG. Данные представлены в виде средних значений ± sem, n = 6.

Мозговое вещество почек является основным источником синтеза PG и местом экспрессии как COX-1, так и COX-2 (25). В одном только мозговом веществе замена ЦОГ-1 на ЦОГ-2 вызывала серьезные нарушения биосинтеза PG, независимо от наличия экзогенных АК (). Интересно, что Tx и 12-гидроксигептадекатриеновая кислота (12-HHT), оба продукта COX-1 / Tx-синтазы, по-разному продуцировались в мозговом веществе мышей, подвергшихся обмену COX. В то время как продукция 12-HHT была снижена у мышей COX-2> 1 и Reversa, аналогично биосинтезу PG, высвобождение Tx было устойчивым во всех 4 штаммах в отсутствие экзогенной АК.Медуллярная эндогенная АК высвобождалась в одинаковой степени у всех 4 линий мышей, а затем превращалась аналогичным образом в гидроксиэйкозатетраеновые кислоты (HETE; 5-HETE, 12-HETE и 15-HETE; дополнительный рисунок S2). Это указывает на то, что у взрослых мышей нокин фермента ЦОГ-2 не шунтирует метаболизм АК в сторону 5-липоксигеназного или 12-липоксигеназного путей соответственно.

Профили эйкозаноидов в мозговом веществе почек у мышей в возрасте 3,5 мес. Рассеченное мозговое вещество почек гомогенизировали, и 100 мкг белка инкубировали с носителем (0.25% этанол, -AA) или AA (50 мкМ, + AA) в течение 10 мин, а затем подвергали анализам жидкостной хроматографии-тандемной масс-спектрометрии. Данные представлены в виде средних значений ± sem, n = 6.

Чтобы лучше понять эти изменения в биосинтезе простаноидов, вызванные нарушением COX-2, была проанализирована экспрессия мРНК генов пути COX (). Анализ qPCR показал, что за исключением Tx A-синтазы 1 (TBXAS1), гены пути COX были более выражены в мозговом веществе. Кроме того, переключение гена Ptgs не влияет на экспрессию большинства терминальных PG-синтаз, таких как PG E 2 -синтаза-1 (PTGES), PG I-синтаза, PG D-синтаза гемопоэтического типа (H-PGDS), липокалин. -тип PGDS (L-PGDS) и семейство 1 альдокеторедуктазы, член B3 [AKR1B3; одна из PGF-синтаз (PGFS)].Мыши COX-1> 2 экспрессировали больше TBXAS1, чем другие 3 линии. Таким образом, нарушение компенсации вряд ли было результатом нарушения связывания с нижележащими PG синтазами, а скорее результатом потери COX-1. Кроме того, экспрессия мРНК 15-гидроксипростагландиндегидрогеназы, фермента деградации PG (26), не различалась среди 4 линий мышей (данные не показаны), что указывает на низкий уровень продукции простаноидов, производных COX-2, в COX-2> 1 и мыши Reversa не являются результатом измененной деградации PG.Взятые вместе, наши данные показывают, что активность двух изоформ в почечном микроокружении неодинакова, и почечный ЦОГ-1 вносит незаменимый вклад в синтез PG. Почечный гомеостаз, по-видимому, преимущественно зависит от ЦОГ-2, а не только в результате его способности к синтезу PG.

Экспрессия

мРНК почечных PG-синтаз у мышей в возрасте 3,5 мес. Относительная экспрессия мРНК терминальных PG-синтаз в мозговом веществе и коре головного мозга почек. qPCR-определенная относительная экспрессия микросомальной мРНК Ptges , PG I-синтазы ( Ptgis ), Hpgds , Lpgds , Tbxas1 и Akr1b3 (1 из PGFS).Данные представлены в виде средних значений ± sem, n = 4–6. * P <0,05 по сравнению с WT.

PG-независимое постнатальное развитие почек

Затем мы обратились к исследованию влияния обмена генов Ptgs на образование эйкозаноидов и развитие почек на P8. Вес почек был сопоставим у всех 4 штаммов (), что указывает на то, что нокаут Ptgs1> Ptgs2 вызывает более мягкую почечную гипотрофию по сравнению с нокаутом Ptgs2 (17).Паттерны экспрессии белка COX, наблюдаемые в почках P8, были аналогичны таковым в почках взрослых с экспрессией нокина COX-2 у COX-2> 1 и мышей Reversa, где COX-1 отсутствовал (). Нормальный постнатальный нефрогенез и созревание почек на этой стадии сохранялись у всех 4 штаммов (). Ptgs генный обмен, по-видимому, не влияет на постнатальное развитие почек на P8. Самое интересное, что простаноидная независимость почечного гомеостаза, наблюдаемая во взрослых почках, все еще применима к почкам P8.В отсутствие экзогенных АК, интактный нативный ЦОГ-1 является основным источником всех проанализированных простаноидов (). Почечный эндогенный АК высвобождается на одинаковом уровне у всех 4 линий мышей. Каждая группа имела сходную способность синтезировать HETE и лейкотриен E 4 (дополнительный рисунок S3).

Постнатальное развитие почек и простаноидные профили костного мозга на P8. A ) Почки собирали на Р8 и измеряли средний вес почек. B ) Вестерн-блоттинг изоформ COX в почках P8 4 линий мышей.Изображения представляют 3 отдельных эксперимента. C ) Типичные световые микрофотографии (окрашивание PAS) почек P8 мышей WT, COX-2> COX-1, COX-1> COX-2 и Reversa. Оригинальное увеличение, × 400; оригинальная масштабная линейка, 100 мкм. D ) Профили простаноидов в почках P8 в отсутствие экзогенных АК. Целую почку гомогенизировали, а затем подвергали тандемным масс-спектрометрическим анализам жидкостной хроматографии. Данные представлены в виде средних значений ± sem, n = 7–8.

Влияние обмена ЦОГ на экспрессию мРНК ренина

Изоформы ЦОГ, особенно экспрессия ЦОГ-2 в коре головного мозга, тесно связаны с синтезом и высвобождением ренина, что способствует физиологическому гомеостазу почек (5, 27). КПЦР показала, что экспрессия мРНК ренина была сопоставима среди всех 4 линий мышей как в мозговом веществе, так и в коре головного мозга взрослых, а также в целых почках P8 (дополнительный рисунок S4). Это также указывает на то, что обмен гена Ptgs не изменяет экспрессию ренина, обычно локализованного в юкстагломерулярных клетках, с меньшей экспрессией в эфферентных артериолах и собирательных протоках (28).Предыдущие исследования показали, что экспрессия ренина и синтеза ренина в ответ на низкое потребление соли снижалась у мышей с дефицитом ЦОГ-2 (29). Эксперименты, проведенные в этом исследовании, показали, что в базовых условиях обмен генов Ptgs приводил к изменениям в синтезе простаноидов, тогда как это оказывало незначительное влияние на экспрессию ренина. Действительно, на исходный уровень натрия в крови и водный баланс не повлиял обмен генов Ptgs , тогда как снижение концентрации натрия в моче у мышей COX-1> 2 и Reversa может отражать тот факт, что потеря нативного COX-2 снижает функцию клубочковой фильтрации (16 ).

ОБСУЖДЕНИЕ

Клинические исследования и исследования на животных показывают, что ЦОГ-1 и ЦОГ-2 по-разному регулируют почечную и сердечно-сосудистую системы (12–14, 30–32). В настоящих исследованиях изучали, повлияет ли переворот генов Ptgs на способность почечной продукции простаноидов и, в свою очередь, насколько эти эффекты могут иметь отношение к изменениям почечной функции и гистологии. В этих исследованиях использовались мыши, которые, как было показано ранее, демонстрируют компенсаторные функции, специфичные для изоформ, и различную степень взаимозаменяемости в отношении способности к образованию PG в макрофагах, тромбоцитах и ​​в биосинтезе, что отражается в метаболитах простаноидов в моче всего тела, либо в базовых условиях ( 23) или при системном воспалении (22).Наши данные показывают, что при базовых физиологических условиях изоформы 2 COX могут преимущественно компенсировать некоторые функции почек. Возможно, это не связано с изменением мощности по производству PG.

Нарушение нативного ЦОГ-1 у мышей ЦОГ-2> 1 или Reversa привело к подавлению способности продуцировать все обнаруженные простаноиды либо в присутствии, либо в отсутствие нативного ЦОГ-2. Мозговое вещество почек и вся почка демонстрировали сходный базальный профиль простаноидов с сопоставимыми уровнями простаноидов у мышей WT и COX-1> 2 и очень низкими уровнями PG у мышей COX-2> 1 и Reversa.Эти результаты согласуются с предыдущими исследованиями, показывающими, что мозговая и корковая способность синтезировать PG в первую очередь зависит от ЦОГ-1 (7). Интактный нативный ЦОГ-1 у мышей с нулевым ЦОГ-2, эффективно генерирующий простаноиды (7), не мог спасти генетический и прогрессирующий сбой у взрослых с дефицитом ЦОГ-2 (12, 14, 24) и нокдауном ЦОГ-2 (18 ) штаммы мышей. С другой стороны, интактный нативный ЦОГ-2 у мышей с нулевым ЦОГ-1, который неэффективно генерирует PG (7), поддерживает почти все аспекты нормальной функции почек (13).Кроме того, в нашем исследовании изменения в способности почек образовывать простаноиды у мышей, лишенных природного ЦОГ-1, не отражали изменений терминальных простаноид-синтаз или нарушения экспрессии ренина. Одна из возможных причин такого несоответствия между уровнем PG и функцией почек заключается в том, что мышам могут не потребоваться высокие уровни PG для поддержания нормального гомеостаза почек. Действительно, имеющиеся данные демонстрируют, что почечные PG практически не влияют на почечный кровоток и скорость клубочковой фильтрации у нормальных животных и здоровых людей (9, 33).Селективное ингибирование ЦОГ-2 не влияло на базальный почечный кровоток (34, 35). На мышиной модели с нокдауном COX-1 мы ранее показали, что уровни PGF в матке и яичниках могут блокироваться до 92%, а остаточных PG по-прежнему достаточно для обеспечения своевременного лютеолиза для начала родов (36). Это также может объяснить, почему у мышей с дефицитом ЦОГ-1 спонтанно не развивались язвы желудка, даже несмотря на то, что уровни желудочного PG у мышей без ЦОГ-1 показали снижение> 99% (13).

Однако продукция PG становится важной для поддержания кровотока и нормальной функции почек в пораженной почке на животных моделях болезненных состояний и у пациентов с сердечно-сосудистыми заболеваниями или почечной недостаточностью (37).Эта вызываемая по вызову генерация PG, скорее всего, зависит, в частности, от активации ЦОГ-2 в плотном желтом пятне и медуллярных интерстициальных клетках. Покойный почечный ЦОГ-2 легко индуцируется различными раздражителями, особенно в состояниях с высоким содержанием ренина, такими как потребление малой соли (2, 38), петлевые диуретики (39), водная депривация (40), ингибиторы ангиотензинпревращающего фермента или блокаторы рецепторов ангиотензина (41–43). Высокая солевая нагрузка также индуцирует экспрессию ЦОГ-2 в мозговом веществе почек (44) и повышает PTGES (45), возможно, посредством нескольких механизмов , включающих гипертонус (21).В этих условиях индуцированная ЦОГ-2 и повышенная продукция простаноидов отражают фактический биосинтез ЦОГ-2 в реактивной системе. В базовых условиях низкий уровень простаноидов, производных ЦОГ-2, у мышей ЦОГ-2> 1, по-видимому, поддерживает нормальную функцию почек. Однако возможность заменить роль ЦОГ-2 становится более сложной задачей в условиях новой конкуренции. Кроме того, ЦОГ-2 может модулировать NO. ЦОГ-2 в сосудистой сети регулирует экспрессию eNOS-зависимой продукции NO (46). ЦОГ-2 в почках может регулировать метаболизм эндогенных ингибиторов NOS, асимметричного диметиларгинина и монометил--1 -аргинина и дистанционно регулировать функции сосудов (47).

Широко признано, что развитие почек у мышей продолжается после рождения, а функция ЦОГ-2 становится наиболее важной во время постнатального развития. Постнатальные дефекты развития почек у мышей с нулевым COX-2 могут наблюдаться через 10 дней после рождения, с истонченной кортикальной мантией и областями небольших незрелых клубочков и тубулярной дисплазией (14, 16, 48). Компенсаторных изменений в почечной экспрессии ЦОГ-1 у мышей с нулевым ЦОГ-2 нет (49). Однако потенциальная взаимозаменяемость между двумя изоформами поддерживает нормальный постнатальный нефрогенез и созревание почек на P8 в нашем текущем исследовании.На этой стадии ЦОГ-1 вносит основной вклад в образование ПГ, и это не может быть заменено нокаутом ЦОГ-2. По мере того как животные стареют, нефропатия у мышей с дефицитом ЦОГ-2 становится более серьезной, с интерстициальным фиброзом и гломерулярным склерозом. Ранее мы продемонстрировали, что нокин ЦОГ-1 может временно компенсировать эту функцию и задерживать, но не предотвращать, почечную патологию, являющуюся следствием делеции ЦОГ-2 (20). Здесь почечные аномалии начали появляться в 3-4 месяца у мышей COX-1> 2 и были увеличены на 7 месяцев.В результате взрослые мыши COX-1> 2 постепенно теряют способность поддерживать функцию почек, хотя способность COX-1 генерировать PG сохраняется. Таким образом, ЦОГ-1 может частично восстанавливать почечный гомеостаз в зависимости от возраста, который не зависит от его способности генерировать PG.

Изучая постнатальное развитие почек и патологии почек у взрослых на новых моделях мышей, мы выявили изоформ-специфичную компенсацию с помощью 2 изоформ ЦОГ в развитии почек и физиологическом гомеостазе.2 изоформы ЦОГ демонстрируют функциональную избыточность и значительную взаимозаменяемость в поддержании постнатального развития и функции почек у молодых животных, хотя только ЦОГ-2 может поддерживать почечный гомеостаз с возрастом животных.

Дополнительные материалы

Эта статья содержит дополнительные данные. Посетите http://www.fasebj.org , чтобы получить эту информацию.

БЛАГОДАРНОСТИ

Эта работа выполнена при поддержке Национального института сердца, легких и крови США (NIH), грант U54 {«type»: «entrez-nucleotide», «attrs»: {«text»: «HL117798 «,» term_id «:» 1051695553 «}} HL117798.C.D.F. занимает канадскую кафедру молекулярной, клеточной и физиологической медицины Уровня 1 и поддерживается грантом MOP142476 Канадских институтов исследований в области здравоохранения. G.A.F. Макнил профессор трансляционной медицины и терапии. L.L.M. был поддержан NIH Training Grant T32 HL07971. Авторы заявляют никакого конфликта интересов.

Глоссарий

12-HHT 12-гидроксигептадекатриеновая кислота
AA арахидоновая кислота
AKR1B3 9015 B3 9013 9013 B-член семейство альдо-1 9015 B-906 азот мочевины
COX циклооксигеназа
H-PGDS простагландин D-синтаза гематопоэтического типа
HETE PG-синтозатетрапин 90-15-L-9015-синтаза 90-15-L-9015-липо-синтозатеновая кислота
P послеродовой день
PAS периодическая кислота-Шифф
PG простагландин
PGFS простагландин 9010 E 906 9 синтагландин 9015 E 9015 E 906 -1
Ptgs простагландин-эндопероксидсинтаза
кПЦР количественная ПЦР
TBXAS1 тромбоксан А синтаза 1
тромбоксан А-синтаза Tx Tx ВЗНОС АВТОРА

X.Ли и К. Д. Функ разработали исследование; X. Li и L. L. Ballantyne проводили эксперименты на мышах; Л. Л. Мазалеуская и Х. Мэн выполнили измерения жидкостной хроматографии-масс-спектрометрии; и X. Ли, Л. Л. Мазалеуская, Г. А. Фитцджеральд и К. Д. Функ написали статью.

СПИСОК ЛИТЕРАТУРЫ

1. Кампеан В., Тейлиг Ф., Палидж А., Брейер М., Бахманн С. (2003) Ключевые ферменты для синтеза простагландинов в почках: сайт-специфическая экспрессия в почках грызунов (крыса, мышь). Являюсь. J. Physiol. Renal Physiol.285, F19 – F32 [PubMed] [Google Scholar] 2. Харрис Р. К., Макканна Дж. А., Акаи Ю., Якобсон Х. Р., Дюбуа Р. Н., Брейер М. Д. (1994) Циклооксигеназа-2 связана с плотным пятном почек крысы и увеличивается с ограничением соли. J. Clin. Вкладывать деньги. 94, 2504–2510 [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Guan Y., Chang M., Cho W., Zhang Y., Redha R., Davis L., Chang S., DuBois RN, Hao CM, Breyer M. (1997) Клонирование, экспрессия и регуляция циклооксигеназы кролика. 2 в интерстициальных клетках мозгового вещества почек.Являюсь. J. Physiol. 273, F18 – F26 [PubMed] [Google Scholar] 4. Hao C. M., Kömhoff M., Guan Y., Redha R., Breyer M. D. (1999) Селективное нацеливание циклооксигеназы-2 показывает ее роль в выживании интерстициальных клеток мозгового вещества почек. Являюсь. J. Physiol. 277, F352 – F359 [PubMed] [Google Scholar] 5. Хао К. М., Брейер М. Д. (2008) Физиологическая регуляция простагландинов в почках. Анну. Rev. Physiol. 70, 357–377 [PubMed] [Google Scholar] 6. Larsson C., Anggård E. (1973) Региональные различия в образовании и метаболизме простагландинов в почках кролика.Евро. J. Pharmacol. 21, 30–36 [PubMed] [Google Scholar] 7. Ци З., Цай Х., Морроу Дж. Д., Брейер М. Д. (2006) Дифференциация простаноидов, производных от циклооксигеназы 1 и 2, в почках и аорте мышей. Гипертония 48, 323–328 [PubMed] [Google Scholar] 8. Ци З., Хао С. М., Лангенбах Р. И., Брейер Р. М., Редха Р., Морроу Дж. Д., Брейер М. Д. (2002) Противоположные эффекты активности циклооксигеназы-1 и -2 на прессорный ответ на ангиотензин II. J. Clin. Вкладывать деньги. 110, 61–69 [Бесплатная статья PMC] [PubMed] [Google Scholar] 9.Данн М. Дж., Замбраски Э. Дж. (1980) Почечные эффекты лекарств, подавляющих синтез простагландинов. Kidney Int. 18, 609–622 [PubMed] [Google Scholar] 10. Хан К. Н., Полсон С. К., Вербург К. М., Лефковит Дж. Б., Мазиас Т. Дж. (2002) Фармакология ингибирования циклооксигеназы-2 в почках. Kidney Int. 61, 1210–1219 [PubMed] [Google Scholar] 11. Гроссер Т. (2006) Фармакология избирательного ингибирования ЦОГ-2. Тромб. Гемост. 96, 393–400 [PubMed] [Google Scholar] 12. Динчук Я. Э., Кар Б. Д., Фохт Р.Дж., Джонстон Дж. Дж., Джеффи Б. Д., Ковингтон М. Б., Контел Н. Р., Энг В. М., Коллинз Р. Дж., Черняк П. М., Горри С. А., Трзаскос Дж. М. (1995) Почечные аномалии и измененная воспалительная реакция у мышей, лишенных циклооксигеназы II. Природа 378, 406–409 [PubMed] [Google Scholar] 13. Langenbach R., Morham SG, Tiano HF, Loftin CD, Ghanayem BI, Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim HS, Smithies O. (1995) Нарушение гена простагландинсинтазы 1 у мышей снижает арахидоновую кислоту -индуцированное воспаление и индуцированная индометацином язва желудка.Клетка 83, 483–492 [PubMed] [Google Scholar] 14. Morham SG, Langenbach R., Loftin CD, Tiano HF, Vouloumanos N., Jennette JC, Mahler JF, Kluckman KD, Ledford A., Lee CA, Smithies O. (1995) Нарушение гена простагландинсинтазы 2 вызывает тяжелую почечную патологию в мышь. Клетка 83, 473–482 [PubMed] [Google Scholar] 15. Athirakul K., Kim H. S., Audoly L. P., Smithies O., Coffman T. M. (2001) Дефицит ЦОГ-1 вызывает натрийурез и повышенную чувствительность к ингибированию АПФ. Kidney Int.60, 2324–2329 [PubMed] [Google Scholar] 16. Норвуд В. Ф., Морхам С. Г., Смитис О. (2000) Постнатальное развитие и прогрессирование почечной дисплазии у мышей с нулевым циклооксигеназой-2. Kidney Int. 58, 2291–2300 [PubMed] [Google Scholar] 17. Слэттери П., Фрелих С., Шрайбер Ю., Нусинг Р. М. (2016) Дозозависимые дефекты развития почек гена СОХ-2. Являюсь. J. Physiol. Renal Physiol. 310, F1113 – F1122 [PubMed] [Google Scholar] 18. Seta F., Chung A. D., Turner P. V., Mewburn J. D., Yu Y., Funk C. D. (2009) Характеристика почек и сердечно-сосудистой системы мышей с нокдауном COX-2.Являюсь. J. Physiol. Regul. Интегр. Комп. Physiol. 296, R1751 – R1760 [PubMed] [Google Scholar] 19. Фрелих С., Слэттери П., Томас Д., Горен И., Феррейрос Н., Йенсен Б. Л., Нусинг Р. М. (2017) Передача сигналов рецептора ангиотензина II-AT1 необходима для циклооксигеназо-2-зависимого постнатального образования нефронов. Kidney Int. 91, 818–829 [PubMed] [Google Scholar] 20. Yu Y., Fan J., Hui Y., Rouzer C. A., Marnett L. J., Klein-Szanto A. J., FitzGerald G. A., Funk C. D. (2007) Целенаправленный обмен генов циклооксигеназы (ptgs) выявляет дискриминантную изоформную функциональность.J. Biol. Chem. 282, 1498–1506 [PubMed] [Google Scholar] 21. Ю. Ю., Стуббе Дж., Ибрагим С., Сонг В. Л., Смит Э. М., Фанк К. Д., Фитцджеральд Г. А. (2010) Циклооксигеназа-2-зависимое образование простациклина и гомеостаз артериального давления: целевой обмен изоформ циклооксигеназы у мышей. Circ. Res. 106, 337–345; erratum (2010)
107
, e19 [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Li X., Mazaleuskaya L. L., Ballantyne L. L., Meng H., FitzGerald G. A., Funk C. D. (2018) Геномный и липидомный анализы дифференцируют компенсаторные роли двух изоформ ЦОГ во время системного воспаления у мышей.J. Lipid Res. 59, 102–112 [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Ли X., Mazaleuskaya L. L., Yuan C., Ballantyne L. L., Meng H., Smith W. L., FitzGerald G. A., Funk C.D. (2018) Переключение генов циклооксигеназы ( Ptgs ) выявляет компенсаторные функции, специфичные для изоформ. J. Lipid Res. 59, 89–101 [Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Yu Y., Fan J., Chen X. S., Wang D., Klein-Szanto A. J., Campbell R. L., FitzGerald G. A., Funk C. D. (2006) Генетическая модель селективного ингибирования COX2 обнаруживает новую передачу сигналов гетеродимера.Nat. Med. 12, 699–704 [PubMed] [Google Scholar] 25. Hao C. M., Yull F., Blackwell T., Kömhoff M., Davis L. S., Breyer M. D. (2000) Обезвоживание активирует NF-kappaB-зависимый механизм выживания в мозговых интерстициальных клетках почек. J. Clin. Вкладывать деньги. 106, 973–982 [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Лю Ю., Цзя З., Сунь Ю., Чжоу Л., Даунтон М., Чен Р., Чжан А., Ян Т. (2014) Постнатальная регуляция 15-гидроксипростагландиндегидрогеназы в почках крысы. Являюсь. J. Physiol. Renal Physiol.307, F388 – F395 [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Харрис Р. С., Брейер М. Д. (2001) Физиологическая регуляция циклооксигеназы-2 в почках. Являюсь. J. Physiol. Renal Physiol. 281, F1 – F11 [PubMed] [Google Scholar] 28. Харрис Р. С. (2013) Физиологические и патофизиологические роли циклооксигеназы-2 в почках. Пер. Являюсь. Clin. Climatol. Доц. 124, 139–151 [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Ян Т., Эндо Ю., Хуанг Ю. Г., Смарт А., Бриггс Дж. П., Шнерманн Дж. (2000) Экспрессия ренина у мышей с нокаутом по ЦОГ-2 на нормальной или низкосолевой диете.Являюсь. J. Physiol. Renal Physiol. 279, F819 – F825 [PubMed] [Google Scholar] 30. Кателла-Лоусон Ф., Рейли М. П., Капур С. С., Куккьяра А. Дж., Де Марко С., Турнье Б., Вьяс С. Н., Фитцджеральд Г. А. (2001) Ингибиторы циклооксигеназы и антитромбоцитарные эффекты аспирина. N. Engl. J. Med. 345, 1809–1817 [PubMed] [Google Scholar] 31. Фитцджеральд Г. А., Патроно С. (2001) Коксибы, селективные ингибиторы циклооксигеназы-2. N. Engl. J. Med. 345, 433–442 [PubMed] [Google Scholar] 32. Мукерджи Д., Ниссен С.Э., Тополь Э. Дж. (2001) Риск сердечно-сосудистых событий, связанных с селективными ингибиторами ЦОГ-2. JAMA 286, 954–959 [PubMed] [Google Scholar] 33. ДиБона Г. Ф. (1986) Простагландины и нестероидные противовоспалительные препараты. Влияние на почечную гемодинамику. Являюсь. J. Med. 80 (1A), 12–21 [PubMed] [Google Scholar] 34. Гонсалес Дж. Д., Ллинас М. Т., Морено К., Родригес Ф., Салазар Ф. Дж. (2000) Почечные эффекты длительного ингибирования циклооксигеназы при повышении уровня ангиотензина II. J. Cardiovasc. Pharmacol.36, 236–241 [PubMed] [Google Scholar] 35. Родригес Ф., Ллинас М. Т., Гонсалес Дж. Д., Ривера Дж., Салазар Ф. Дж. (2000) Изменения почек, вызванные ингибитором циклооксигеназы-2 при нормальном и низком потреблении натрия. Гипертония 36, 276–281 [PubMed] [Google Scholar] 36. Yu Y., Cheng Y., Fan J., Chen X. S., Klein-Szanto A., Fitzgerald G.A., Funk C. D. (2005) Дифференциальное влияние нокдауна простагландин H-синтазы 1 на тромбоциты и роды. J. Clin. Вкладывать деньги. 115, 986–995 [Бесплатная статья PMC] [PubMed] [Google Scholar] 37.Вейн Дж. Р., Бахле Ю. С., Боттинг Р. М. (1998) Циклооксигеназы 1 и 2. Анну. Rev. Pharmacol. Toxicol. 38, 97–120 [PubMed] [Google Scholar] 38. Ян Т., Сингх И., Фам Х., Сан Д., Смарт А., Шнерманн Дж. Б., Бриггс Дж. П. (1998) Регулирование экспрессии циклооксигеназы в почках с помощью потребления соли с пищей. Являюсь. J. Physiol. 274, F481 – F489 [PubMed] [Google Scholar] 39. Манн Б., Хартнер А., Йенсен Б. Л., Каммерл М., Кремер Б. К., Курц А. (2001) Фуросемид стимулирует экспрессию циклооксигеназы-2 макулы densa у крыс.Kidney Int. 59, 62–68 [PubMed] [Google Scholar] 40. Ян Т., Шнерманн Дж. Б., Бриггс Дж. П. (1999) Регулирование экспрессии циклооксигеназы-2 в мозговом веществе почек с помощью тоничности in vivo и in vitro. Являюсь. J. Physiol. 277, F1 – F9 [PubMed] [Google Scholar] 41. Cheng H. F., Wang J. L., Zhang M. Z., Miyazaki Y., Ichikawa I., McKanna J. A., Harris R. C. (1999) Ангиотензин II ослабляет экспрессию корковой циклооксигеназы-2 в почках. J. Clin. Вкладывать деньги. 103, 953–961 [Бесплатная статья PMC] [PubMed] [Google Scholar] 42. Ван Дж.Л., Ченг Х. Ф., Харрис Р. С. (1999) Ингибирование циклооксигеназы-2 снижает содержание ренина и снижает кровяное давление в модели реноваскулярной гипертензии. Гипертония 34, 96–101 [PubMed] [Google Scholar] 43. Вольф К., Кастроп Х., Хартнер А., Гоппельт-Штрюбе М., Хильгерс К. Ф., Курц А. (1999) Ингибирование системы ренин-ангиотензин усиливает экспрессию циклооксигеназы-2 в плотном пятне. Гипертония 34, 503–507 [PubMed] [Google Scholar] 44. Ян Т., Лю М. (2017) Регуляция и функция почечной медуллярной циклооксигеназы-2 при высокой солевой нагрузке.Фронт. Biosci. 22, 128–136 [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Ye W., Zhang H., Hillas E., Kohan DE, Miller RL, Nelson RD, Honeggar M., Yang T. (2006) Экспрессия и функция изоформ ЦОГ в мозговом веществе почек: данные о регуляции чувствительности к соли и артериального давления . Являюсь. J. Physiol. Renal Physiol. 290, F542 – F549 [PubMed] [Google Scholar] 46. Yu Y., Ricciotti E., Scalia R., Tang S. Y., Grant G., Yu Z., Landesberg G., Crichton I., Wu W., Puré E., Funk C.D., FitzGerald G.A.(2012) Сосудистый ЦОГ-2 модулирует кровяное давление и тромбоз у мышей. Sci. Пер. Med. 4, 132ra54 [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Ахметадж-Шала Б., Киркби Н.С., Ноулз Р., Аль-Ямани М., Мази С., Ван З., Такер А.Т., Маккензи Л., Армстронг П.С., Нусинг Р.М., Томлинсон Дж. А., Уорнер Т.Д., Лейпер Дж., Mitchell JA (2015) Доказательства, связывающие потерю циклооксигеназы-2 с увеличением асимметричного диметиларгинина: новое объяснение сердечно-сосудистых побочных эффектов, связанных с противовоспалительными препаратами.Тираж 131, 633–642 [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Kömhoff M., Wang J. L., Cheng H. F., Langenbach R., McKanna J. A., Harris R. C., Breyer M. D. (2000) Селективные ингибиторы циклооксигеназы-2 нарушают гломерулогенез и развитие коркового вещества почек. Kidney Int. 57, 414–422 [PubMed] [Google Scholar] 49. Чжан Дж., Гурха С., Рэгоу Р., Баллоу Л. Р. (2002) Тканеспецифическая компенсаторная экспрессия циклооксигеназы-1 и -2 у трансгенных мышей. Простагландины Other Lipid Mediat. 67, 121–135 [PubMed] [Google Scholar]

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

(PDF) Изменение генов циклооксигеназы (Ptgs) позволяет выявить компенсаторные функции, специфичные для изоформ

29

50.Barnett, J., J. Chow, D. Ives, M. Chiou, R. Mackenzie, E. Osen, B. Nguyen, S. Tsing, C. Bach, J.

,

Freire и др. 1994. Очистка, характеристика и селективное ингибирование человеческого простагландина G / H

синтазы 1 и 2, экспрессируемого в бакуловирусной системе. Biochim Biophys Acta 1209: 130-139.

51. Гирсе, Дж. К., С. Д. Хаузер, Д. П. Крили, К. Кобольд, С. Х. Рангвала, П. К. Исаксон и К. Зайберт.

1995. Экспрессия и селективное ингибирование конститутивных и индуцибельных форм цикло-

оксигеназы человека.Biochem J 305 (Pt 2): 479-484.

52. Редди С. Т. и Х. Р. Хершман. 1994. Индуцированный лигандом синтез простагландина требует экспрессии

гена простагландинсинтазы TIS10 / PGS-2 в мышиных фибробластах и ​​макрофагах. J Biol

Chem 269: 15473-15480.

53. Редди, С. Т., Х. Ф. Тиано, Р. Лангенбах, С. Г. Морхам и Х. Р. Хершман. 1999. Genetic

доказательств различных ролей ЦОГ-1 и ЦОГ-2 в немедленной и отсроченной фазах синтеза простагландина

в тучных клетках.Biochem Biophys Res Commun 265: 205-210.

54. Браш А. Р. 2001. Арахидоновая кислота как биоактивная молекула. Дж. Клин Инвест 107: 1339-1345.

55. Ли, X., L. L. Ballantyne, X. Che, J. D. Mewburn, J. X. Kang, R. M. Barkley, R. C. Murphy, Y. Yu,

и C. D. Funk. 2015. Эндогенно произведенные омега-3 жирные кислоты ослабляют сосудистое воспаление и гиперплазию неоинтимы

за счет взаимодействия с рецептором 4 свободных жирных кислот у мышей. J Am Heart Assoc 4: e001856.

56. Threadgill, D. W., A. A. Dlugosz, L. A. Hansen, T. Tennenbaum, U. Lichti, D. Yee, C. LaMantia,

T. Mourton, K. Herrup, R.C. Harris, and et al. 1995. Целевое нарушение рецептора EGF мыши: влияние генетического фона

на мутантный фенотип. Наука 269: 230-234.

57. Янг Т., Ю. Г. Хуанг, В. Е, П. Хансен, Дж. Б. Шнерманн и Дж. П. Бриггс. 2005. Влияние

генетического фона и пола на гипертонию и почечную недостаточность у мышей с дефицитом ЦОГ-2.Am J Physiol

Renal Physiol 288: F1125-1132.

58. Ван Х., В. Г. Ма, Л. Техада, Х. Чжан, Дж. Д. Морроу, С. К. Дас и С. К. Дей. 2004. Спасение

женского бесплодия от потери циклооксигеназы-2 путем компенсаторной активации циклооксигеназы-

1 является функцией генетической структуры. J Biol Chem 279: 10649-10658.

Рак легкого | SpringerLink

Об этой книге

Введение

Молекулярные лабораторные методы могут значительно помочь в диагностике и лечении рака легких, ведущей причины смерти во всем мире.В книге «Рак легких», том 1: «Методы и обзоры молекулярной патологии» ведущие врачи, ученые и известные исследователи рассматривают новые методы определения этиологии различных видов рака легких и представляют легко воспроизводимые методы исследования связанного с ними множества генетических аномалий. Описанные методы позволяют обнаруживать эти изменения на клеточном уровне, уровне ДНК и белка, изучать развитие рака легких in vitro и in vivo — in situ или в форме метастазов — и тестировать целевые методы лечения с подробным описанием модельные системы.В разделе о моделях животных даются подробные инструкции по настройке и тестированию этих систем, которые редко описываются в литературе. В сопутствующем томе «Рак легких, том 2: диагностические и терапевтические методы и обзоры» основное внимание уделяется диагностике рака легких с помощью молекулярного анализа клинических образцов и предоставлению множества новых методов лечения.
Всеобъемлющий и информативный, Рак легкого, Том 1: Методы и обзоры молекулярной патологии освещает этиологию рака легких и предоставляет надежные методы обнаружения ответственных генетических мутаций на клеточном уровне, уровне ДНК и белков.Вместе эти два тома представляют собой беспрецедентный ресурс для тех, кто хочет лучше понять, как это заболевание диагностируется и лечится, и какие новые методы могут быть доступны для улучшения обоих процессов.

Редакторы и филиалы

  1. 1. Детская больница Лос-Анджелес, США

Библиографическая информация

  • Название книги Рак легких
  • Подзаголовок книги Том 1: Методы и обзоры молекулярной патологии
  • Редакторы Барбара Дрисколл
  • Название серии Методы молекулярной медицины ™
  • DOI https: // doi.org / 10.1385 / 1592593232
  • Информация об авторских правах Humana Press 2003
  • Имя издателя Humana Press, Тотова, Нью-Джерси
  • электронные книги Протоколы Springer
  • ISBN в твердом переплете 978-0-89603-985-8
  • ISBN в мягкой обложке 978-1-4899-3912-8
  • электронная книга ISBN 978-1-59259-323-1
  • Серия ISSN 1543–1894
  • Серия E-ISSN 1940-6037
  • Номер издания 1
  • Число страниц XXI, 594
  • Количество иллюстраций 0 ч / б иллюстраций, 0 иллюстраций в цвете
  • Темы Онкология
  • Купить эту книгу на сайте издателя

Новости округа Симпсон из Менденхолла, Миссисипи, 1 августа 1996 г. · 7

Обитуарий JLSS1E ГАСТОН ЛИТЕР Джесси Гастон Лупер, 86 лет, пенсионер из Прентисса, скончалась 29 июля 19 июля от сердечной недостаточности в больнице Джеффа Дэвиса в Прентиссе.Служба состоялась в 14:00, среда, 31 июля 1996 г., в церкви Уайт-Сэндс в Прентиссе с захоронением на церковном кладбище. Похоронное бюро Маги в колониальной часовне позаботилось о благоустройстве. Мистер Лупер был уроженцем графства Копиа. Он был членом масонской ложи 448 в Прентиссе и членом баптистской церкви Уайт Сэндс. Среди выживших — его жена Иделл Лупер из Прентисса; сыновья, Джимми Лупер из Прентисса, Дон Лупер из Пилы; дочери, Пегги Стеннетт из Маги, Пэтси Хайпс из Прентисса, 12 внуков и 13 правнуков.ДЖОРДЖИЯ МАЭ СЛЕЙ — Джорджия Мэй Слэй, 88 лет, пенсионерка Брэндона, умерла в воскресенье, 28 июля 1996 года, от рака в больнице Святого Доминика Джексона. Службы были во вторник, 30 июля 1996 года, в Колониальной часовне с захоронением на кладбище Нового Вифлеема в Пиноле. Аранжировками занималась похоронная служба Менденхолла в колониальной часовне. Миссис Слей была уроженкой графства Симпсон. Она была медсестрой на пенсии. Она работала в баптистской больнице Миссисипи. Среди выживших — ее сын Рональд Линн Слей из Брэндона; дочь Барбара Хайнс из Брэндона; брат, Джонни Эшли.Пинола; сестры, Лорея Дерден из Кемпа, Техас, Вильма Макдональд из Джексона, Эрлин Бэнкхед из Кристал-Спрингс; 7 внуков и 2 правнука. ИВОННИ ДАКВОРТ ИЛМ Ивонни Дакворт Хэм, 84 года из Маги, владелец бизнеса и школьный учитель на пенсии, умерла от сердечной недостаточности в понедельник, 29 июля 1996 года, в больнице общего профиля Маги. Службы были в 15:00, вторник, 30 июля 19, в баптистской церкви Gooduater с захоронением на церковном кладбище. Аранжировками занималось похоронное бюро Mims Mitchell Magee. Миссис Хэм окончила среднюю сельскохозяйственную школу округа Симпсон и Университет Южного Миссисипи со степенью бакалавра.Степень S. и M.A. Она начала преподавать в раннем возрасте 18 лет и преподавала в школах округа Симпсон, Риалс-Крик, Гудвотер, Олд Хикори, Дикси и Маги. Ее педагогическая карьера насчитывала более 30 лет. Она была источником вдохновения для молодежи сообщества. В школе она работала с ваусом в 4-х клубе и баскетболе. Она была членом Ассоциации образования Миссисипи, Ассоциации учителей-пенсионеров и Ассоциации выпускников Университета Южного Миссисипи. Она была членом баптистской церкви Goodwater в Маги, где преподавала в воскресной школе в детском отделении.Она была неутомимым работником и преданной служительницей своей церкви и принципов, в которые она верила. Выйдя на пенсию с преподавания, она открыла розничный универмаг в Маги, ранее называвшийся Magee Discount. Среди выживших — ее сын Роберт Дэвид Хэм из Мейи; внуки: Дэвид Хэм из Хаттисберга, Анджела Хэм из Риджленда, Гэйг Хэм из Маги; внук, Трэвис Хэм из Маги; сестры, Лейла Лэнгли и Бобби Фостер, обе из Маги; и несколько племянниц, племянников и множество друзей.CLXDY GAIL EUBANKS Синди Гейл Юбэнкс, 35 лет, домохозяйка Mt. Олив умерла в четверг, 25 июля 1996 года, в автокатастрофе в Медицинском центре Университета в Джексоне. Службы были в 16:00 в субботу, 27 июля 1996 г., в часовне Мимса Митчелла с захоронением на кладбище баптистской церкви на Голгофе в округе Симпсон. Аранжировками занималось похоронное бюро Mims Mitchell Magee. Миссис Юбэнкс была уроженкой Маги и членом Церкви Христа Маги. Среди выживших — ее муж Стэнли Юбэнкс; дочери, Шина Мари Уильямс и Лейси Гейл Уильямс, обе из Mt.Оливковый; сестры, Эвелин Дейли из Менденхолла и Дебора Салливан из Маги. КОЛОНИАЛЬНАЯ ЧАСОВНЯ UPTOX-MIMS Маги, Менденхолл, Тейлорсвилл, Лорел, Форест, Бэй-Спрингс и Роли ПРЕДВАРИТЕЛЬНАЯ НУЖНОСТЬ КОЛОНИАЛОВ ..J Обеспечивает душевное спокойствие для вас и безопасность для ваших близких. 849-5031 847-1733 Качественное и достойное обслуживание с 1971 г. I 1 МЕНДЕНХОЛЛЬСКАЯ ЦЕРКОВЬ ХРИСТА 3313 Highway 49 Mendenhall 847-1164 Мы говорим об ИСТИНЕ, потому что уф-эйр о ВАС! Воскресная школа 10.O0 м. Поклонение. 11:00 утра. Вечернее богослужение 6:00 р.м. Мы б. Изучение Библии 19:00 Бесплатные изучения Библии: позвоните по телефону 847-1164, если мы сможем вам чем-либо помочь! Министр: Джеймс С. Гай Контроль кокцидиоза у коз Дики Селмон Многие производители, которые долгое время работали в козоводстве на ограниченном уровне, могут или не могут понять проблемы, связанные с управлением большими стадами коз на ограниченных площадях. В таких условиях могут произойти катастрофические вспышки болезней, таких как коккодии, которые являются внутриклеточными паразитами, которые живут и растут в клетках, выстилающих желудочно-кишечный тракт своего хозяина.По мнению исследователей, первое начало этого заболевания — внезапный понос с неприятным запахом из-за фекалий, содержащих слизь и кровь. Кровь может иметь вид темного пятна кала или прожилок. У пораженных животных также может быть немного повышенная температура тела, но обычно температура нормальная или ниже нормы. По словам местных производителей, другими признаками заболевания являются снижение аппетита, низкое потребление корма и прибавка в весе, обезвоживание. Производители добавили, что, хотя такие видимые признаки присутствуют, наблюдается острый кокцидоз, в то время как хронический кокцидоз продолжается постоянно.По иронии судьбы, у таких животных, как люди, иногда может развиться устойчивость к заболеванию организма. Но, по словам Джеймса Клиберна, президента мясного кооператива Южного штата и жителя общины Харрисвилл в округе Симпсон, ключевым моментом является профилактика. Он сказал: «Экономически привлекательно предотвращать, чем контролировать во время начала». Хотя средства правовой защиты могут иногда варьироваться от производителя к производителю, Тэмми Клиберн, зарегистрированный производитель коз и член Южного государственного мясного кооператива коз, говорит, что профилактика может быть либо успехом, либо неудачей в борьбе с кокцидиями.Далее она сообщила, что ее метод профилактики заключается в кормлении пораженных животных одним фунтом анти-кокса в смеси с двадцатью пятью фунтами минерала Nutrina 12-12. В поддержку вышеупомянутых рекомендаций другими методами борьбы являются кокцидостаты, такие как сульфаниламиды, ионофоры, аридный ампролим и монензин. Однако эти препараты не убивают кокцидии напрямую, а подавляют их рост. Хотя хорошая санитария поможет предотвратить заболевание, помните, что кокцидии возникают, когда животные проглатывают большое количество яиц или ооцист, и решение будет заключаться в том, чтобы не дать животным проглотить большие объемы.Использование кормов, содержащих кокцидиостаты, до вспышки болезни поможет. Профилактика — ключ к успеху, и свяжитесь с Кооперативом мясных коз Южного штата по телефону (601) 847-1789 или с Дики Селмоном, агентом по развитию сельского хозяйства, по телефону (601) 847-1626. Книжный мир J u VA от Broox Sledge Чудеса природы — это чистая магия. Лосось находит ручей своего рождения. Бабочки-монархи и колибри, путешествующие в Мексику и Центральную Америку или из них. Или маленькие морские черепахи, плывущие своими ножками от песчаного побережья до кораллового атолла в почти безграничном Тихом океане.Или мириады великолепных существ, обитающих на коралловых рифах, внутри них и вокруг них. Экзотические морские животные тысячами разных цветов в бесконечном количестве форм и функций. Возьмите для детей в вашей семье книгу Норберта Ву «Город под морем», изданную Atheneum, подразделением Саймона и Шустера. Эта история жизни на коралловом рифе представляет собой яркое образование о жизненных циклах таких в высшей степени красивых и странных форм жизни, как скат-манта, трудолюбивый губан, синяя рыба-ангел, вечно голодная мурена, фарфор. краб, корова, крылатка, рыба-попугай, осьминог, живые губки и другие существа, которых ваш разум едва ли может принять.Эта книга — мини-образование о наших могучих океанах и формах жизни, которые питают наши бескрайние просторы с соленой водой. Eastside Baptist Church of Magee 703 Fourth St., SE Послушайте Evangelist- ‘j; 4 VentiQaaast s ST Службы каждый вечер в 19:00. 4–9 августа Детский сад предоставлен музыкальным директором и музыкальным руководителем Певец Боб Харрис из D’Lo Rev. Робби Тингл из Форт-Смита, штат Арканзас. 35 Н. Форест, МС Двери открываются в 18:00. 5 БЕСПЛАТНЫХ игр в 6:30 469-3333 jfr «W ‘1 5U Pig $ 200 6: 30-7: 30 Самый знаменитый алмаз в мире — Кохинур, который был подарен королеве Виктории в 1850 году. Ост-Индская компания.1,1 7- 300 $ Packgames Pig $ 200 1 — $ 1000 Обложка Все 6: 30-7: 30 Двери открываются в 18:00. 5 БЕСПЛАТНЫХ игр по 50 $ в 6:30 2 игры Packgames по 150 $ 499 Покрытие All Pig $ 200 6: 30-7: 30 m..mM & amp;: m i ts. 7 — $ 150 Packgames Pig $ 200 1 — $ 1000 Покрытие всех 4: 30-5: 30 Двери открываются в 16:00. 5 TREE 4:30 19 «MagnavoxTV — 199 долларов 27 Консольный телевизор — 499 долларов 25» Портативный телевизор — 319 долларов 15 куб. Морозильная камера — 399 долларов 8,8 куб. Морозильная камера — 329 долларов Холодильник 21 кубический фут с льдогенератором — 649 долларов 3 шт. Матрац (фирменный) — 189 $ Намного дороже! II.t acjss EX из 6 офтимиксов fox fjzixiy dzchA zJfayzz i ai odpjkSibj -GharnSjzx (DJ- dommsxcL LjiotiLoxzJ. Svznt — и -1,1

Edgard & Cooper Comida Húmeda para Perros Senior с Conejo y Ciruelas

Edgard & Cooper Comida Húmeda para Perros Senior с Conejo

Alimento Para Perros Senior De Cualquier Tamaño y Raza 100% Natural Sin Cereales

Edgard & Cooper Comida Húmeda para Perros Senior con Conejo, Patata y Ciruelas es specialmente formulado para perros mayores.

Se trata de un alimento complementario para perros Senior , pero que puede darse solo o mezclado con el pienso normal para ablandarlo o aportar un extra de sabor.

Грасиас с натуральными ингредиентами и адаптацией, имеет лата для пожилых людей, фунтов стерлингов с использованием включенных ингредиентов в перросах с ограниченными возможностями. Es rica en carne fresca de conejo, patatas y ciruelas que además de aportar nutrites y un bajo nivel de calorías, hacen que el alimento esté delicioso.

Edgard & Cooper Comida Húmeda para Perros Senior con Conejo contiene además semillas de lino, laurel, tomillo y pato. Estosalendientes combinados aromatizan la recta, la hacen súper apetecible y además la llenan de ácidos grasos Omega 3 года 6.

Los ácidos grasos son esenciales para nuestros peludos y más para los de edad avanzada. Gracias a ellos garantizamos la salud de la piel, pelo, huesos, corazón y retrasamos el envejecimiento celular.

Edgard & Cooper включает в себя en este y en muchas otras Recetas, probióticos para cuidar la salud digestiva de nuestros mejores amigos y su fórmula patchada PHENOMIND (extracto de uva y arándanos azules), который не является эффективным антиоксидным.

Beneficios de Edgard & Cooper Senior Conejo

  • Pienso Sin Cereales Apto para Digestiones Sensibles
  • Receta Adaptada a los Perros Senior (от 7 лет)
  • Apta para todas las razas y tamaños de perros
  • Croquetas Bajas en Calorías para Evitar los kilos de más propios de los Perros Senior
  • Contiene Semillas de Lino y Aceite de Salmón: Ingredientes ricos en Omega 3 que previenen el envejecimiento cerebral
  • Con PHENOMIND extracto de arándanos azules y uva de alto poder antioxidante
  • Carne fresca que no se somete a ningún tipo de processado
  • Frutas, verduras y extractos herbales ecológicos proceduredentes huertos sostenibles
  • Cocción lenta y en pequeñas partidas de alimento que garantiza la preservación de los components nutricionales
  • Envases reciclables, biodegradable y tintas con base agua libres de tóxicos

EP6 резка двигателя.Почему не работают двигатели EP6

Резец двигателя и поршневые кольца — Процедура, направленная на снятие нагара с деталями поршневой группы. А именно очистка от продуктов сгорания некачественного топлива и масел с помощью поршней, колец и клапанов. Как своими руками, так и на СТО проводится с использованием специальных средств — химических составов, растворителей и растворителей. Удалить кокс можно 4 способами, три из которых осуществляются, не открывая мотор, и являются исключительно профилактическими мерами.Избавиться от Нагары можно не только специально предназначенной жидкостью, но и средствами, приготовленными самостоятельно. Причем и те, и другие будут иметь хорошую эффективность. Качество фрезы зависит от процедуры, аккуратности выполнения и целесообразности в конкретной ситуации.

Любой резак хорош как профилактика! Как гигиена полости рта у человека. Лучше всего производить периодически, не доводя состояние двигателя до критического, когда «реанимировать» можно только переборкой. Очень актуально для немецких двигателей (VAG и BMW), склонных к расходу масла.

Чтобы справиться с такой задачей, вам придется изучить список популярных средств, дающих возможность изготавливать предметы, их характеристики, свойства, отзывы о реальном использовании, а также инструкции, по которым проводится процедура.

Зачем нужен безжалостный

Первый логичный вопрос, который возникает у начинающих автовладельцев — зачем вообще экскаваторный двигатель? Второй — что собственно можно почистить с помощью CPG и CSM? Хитрость колец снижает их подвижность, отложения на поршне уменьшают объем камеры сгорания, а нагар на клапанах не дает им нормально работать, что влечет за собой расход масла, куртки на стенках цилиндров, снижение мощности двигателя, горение клапаны, и как следствие.Поэтому основная задача отсечки — убрать царапину сверху на поршне, перемешать кольца и прочистить масляные каналы.


Такая регулярная процедура устранит неисправности, вызванные появлением отложений. В частности, исчезнет детонация и выравнивается небольшой разброс компрессии по цилиндрам. Но чтобы избавиться от СИЗО, типичному все же придется устранить и причину горения материала в камере сгорания.

Одно из химических средств, относящихся к так называемым «мягким» или «жестким» лентам, поможет справиться с продуктами отложений. Стоит отметить, что у каждого из них есть как свои достоинства, так и недостатки.

10 лучших инструментов для резки

С учетом исключительно результатов реального использования и стоимости, а не рекламной кампании, составим список из 10 средств из разных ценовых категорий, вариантов применения и методов борьбы с нагаром. Следует отметить, что все они подходят как для бензинового, так и для дизельного двигателя, так как принципиальной разницы нет.Это может быть только слой нагара, более или менее.

Итак, какой патрон лучше выбрать из всех представленных на рынке? Тестовые испытания, показавшие хороший результат и количество положительных отзывов, позволили собрать популярные фонды в таком порядке:

Средство Цена Метод рисования Метод Вариант приложения Область приложения Дополнительные процедуры
Мицубиси Шумма. 1500р. грубый химический без вскрытия поршневая группа
GZOX. 500р. мягкий химический без вскрытия поршневая группа требуется замена масла и фильтра
Кенгуру ICC300. 400р. мягкий химический без вскрытия необходимо заменить масло и фильтр
Хадо Верелюбе. 800р. грубый химический без вскрытия> верхний поршень и кольца нужно заменить масло и фильтр, а в цилиндрах капля масла
Реаниматор Greenol 900р. жесткий химический верхний Поршень и кольца необходимо заменить масло и фильтр, а также очистить поддон
ЛАВР МЛ-202 400р. грубый химический без вскрытия и / или особых деталей верх Поршень и кольца требуется замена масла и фильтра
Едиал 300р. динамический химический без вскрытия поршневая группа без замены масла, но с заменой свечей
Ацетон и керосин 160р. жесткий химический / механический без вскрытия и вскрытия поршень и кольца лучший эффект При смешивании 1: 1 + моторное масло. И выдерживают 12 часов.
Димексид 150р. жесткий химический без вскрытия верхний поршень и кольца работает только на 50-80
Средство для очистки тарелок 300р. жесткий химический / механический с отверстием поршень и кольца выдержка не более 5 минут

* Растворители, которые добавляются в качестве присадки к топливу для очистки форсунок, мы не включали список (исключение является стандартным, потому что это действительно отсечка), так как их влияние на NAG минимально, действие в основном направлено на очистку форсунок, а не деталей поршневой группы.Есть еще 204-СУРМ-НМ, он заливается и в топливо, и в цилиндры, но данных о нем очень мало, чтобы делать объективные выводы.

** Отдельно хотим отметить, что в рейтинг мы не включали те патроны, которые заливаются в качестве добавки к маслу (BG-109, Liqui Moly Ol-Schlamm-Spulung или Ormex), так как их действие эффективно только в комплексе, и промахнуться по загорелым Поршням без толку.

Водный гидроперит, который некоторые экспериментаторы пытаются применить для удаления нагара с помощью поршней, не рекомендуется.Мало того, что он полностью не справится с этой задачей, неприятностей гораздо больше (нужно подключить капельницу на впускной коллектор). Перекись водорода можно использовать как кровавое средство для очистки дроссельной заслонки. В такой ситуации с профессиональными растворителями нужны навыки, иначе можно получить гидротерапию.

Очистка поршня от Nagara

Как видите, далеко не все рекламируемые средства для округления универсальны и внимательны. Только первые три средства, которые залиты в цилиндры, помогут справиться с перекосом колец и улучшить ситуацию с расходом масла.Другие не дадут такого радостного эффекта, особенно когда ситуация запущена. А если говорить об экономических средствах , то даже лучше применять их исключительно только непосредственно для очистки поршней, клапанов или блока цилиндров с капремонтом, а не для резки двигателя, когда имеет место расход масла и снижение компрессии. Потому что они очень агрессивные И они могут есть краску, алюминиевые поршни или блокировать внутреннее сгорание.

Для того, чтобы понять, почему, и узнать о каждом средстве более подробно, ознакомьтесь с характеристиками, особенностями использования и отзывами автовладельцев, когда-то испытавших ту или иную жидкость, предназначенную для удаления масляных отложений.

Характеристики, особенности и отзывы — Рейтинг лучших патронов

Лучший результат при замачивании клапанов и поршней. Там, где нагар не открывается, он становится мягким и легко удаляется механическим путем.

Мицубиси Шумма. № Кондиционер для двигателя Японские средства для вытяжки двигателя №1 По мнению большинства как профессиональных операторов автомобилей, так и опытных водителей. Шумопоглотитель от Mitsubishi представляет собой растворитель на масляной основе, на 20% этиленглюколя и моноэтилового эфира, пахнет аммиаком, является представителем жесткого круглого.Этот очиститель представляет собой активную пену, предназначенную для очистки двигателей GDI (с прямым впрыском), но фактически удаляет нагар в любом двигателе. Поступил в баллоны через трубку. Он выдерживается 30 минут, но, по рекомендации, наиболее эффективен при выдержке от 3 до 5 часов. Не агрессивен по отношению к крышке заправки масла.

Одного цилиндра хватит только на двигатель объемом 1,5 л. Режущий агент отлично справляется с нагарами на поршнях, кольцах, клапанах и камерах сгорания.Его можно применять не только без разборки двигателя, но и растирать детали поршневой группы для удаления шлама. Цена на шумму более чем огромная, в среднем около 1500 рублей за стандартные 220 мл. воздушный шар. Во многих регионах России купить довольно сложно. Но такой азарт вполне оправдан. И если его применение не дало результатов, можно с уверенностью сказать, что уже может помочь только ремонт. Код заказа — MZ100139EX.

Отзывы
  • Был впечатляющий расход масла, но после 2-х часового нахождения препарата в поршне положение значительно улучшилось.Кстати пишут, что масло менять не надо, советую поменять все так как больше половины жидкости в результате резца ушло на Картер
  • О резке шума узнал из видео , где испытания проводились на примере снятия нагара с клапана. Решил испытать на своей машине, уложить кольца. И заодно решил убрать ЕГР. С задачей средства справились на ура, видимо там было не так уж и плохо.
  • На свой Мистурбиса Лансер надо было раз в неделю заливать масло. По рекомендации решил использовать оригинальный очиститель двигателя. После чистки минут пять пытались завести двигатель. Было много дыма и ила. В итоге машина немного поехала в бейреа, и всего на 2 мм ушло 500 км до Щупы.
  • Произошел большой взрыв, о котором знающие люди предположили, что клапан в Нагаре. Я купил шум, взял воздухозаборник и выстрелил во впускной клапан и в цилиндры.Через 30 минут при осмотре я увидел, что они действительно стали чистыми. После процедуры двигатель перестал трясти, обороты прошли. Хочу предупредить, что пара капель попала в фару и теперь по кузову следы не осталось, думаю справится только полировка.
читать все
  • Плюсы:
  • Быстрая и качественная резка как колец, так и клапанов;
  • Можно почистить нагар на поршнях, дроссельных заслонках и рециркуляции отработавших газов;
  • Используется как без вскрытия мотора, так можно замачивать и разбирать детали.
  • Минусы:
  • Очень дорого;
  • Краска в поддоне хоть и не кушает, но при попадании в пластик голова или корпус оставляет мутный след.

Эффект от уборки почти такой же, как у всех, кто любил шум, только в 3 раза дешевле. Так что можно назвать, что это лучшее народное средство от серых моторов.

GZOX. INJECTION & CARB CLEANER Химические вещества, разработанные японской компанией Soft99.Уже из названия понятно, что предназначается для чистки форсунок и карбюраторов, но хорошо себя зарекомендовало и при прямолинейном движении двигателя. В инструкции нет данных, как убрать непослушный на поршнях, но пусть это не пугает, как и прочие чистящие жидкости, налитые в камеру сгорания.

В состав входит масляный растворитель и этилгликоль. Создает маслянистую пленку на поверхности, поэтому, несмотря на то, что выглядит как средство из перегородки от жестких фрез, действие намного мягче.В качестве профилактики рекомендуется наносить каждые 10 тыс. Км.

Балона 300 мл хватит на большинство автомобилей с двигателем 1,5 — 1,8 л, а также хватит для V-образного 6-цилиндрового двигателя. По результатам испытаний было показано, что ГСОКС отменяется поршнем Нагара и может размешиваться в кольцах. Но вскрыть зацементированные коксом поршни все равно не удалось. Состав хоть и почти схож с ведущим, но все же немного проигрывает в исполнении. В продаже более доступный, чем шумовой.Средняя стоимость в пределах 500-700 руб. Код для заказа GZOX — 1110103110.

Отзывы
  • Удалось добиться результата по снижению расхода масла с 1 литра на тысячу до разумных 100-200 мл. Но так как нормирование GZOX не является прямым назначением инструмента, главное — соблюдать последовательность: подать на каждый цилиндр по 5 секунд; Первый час перемещать вал каждые 15 заливок; Через 1 час добавить остальные остатки; Допустим, 4-5 часов.
  • В свободном доступе найти было сложно, но усилия того стоили. Поршень почти идеально очищен. Расход масла снизился в 4 раза. 15 тыс. Км еще раз хочу повторить.
  • Имеется опыт применения отсечки РЗОКС на нескольких типах моторов (VAG в том числе) = результат положительный во всех случаях использования (выравнивание компрессии, уменьшение масслота, улучшение параметров тяги и расхода).
  • Excellent удаляет углеродистые отложения, смолы и другие загрязнения.Но учтите, что в GZOX — аммиак, который «ест» алюминий. Чугун / Сталь — Не вызывает коррозии.
читать все
  • Плюсы:
  • Используется для чистки карбюратора, дроссельной заслонки, форсунок и срезания колец;
  • Мягкое воздействие на поршень;
  • Достаточно для распила шестицилиндрового двигателя.
  • Минусы:
  • Не протягивает масляные каналы;
  • Ввиду революции популярности и уровня эффекта, в некоторых магазинах цена иногда переводится.

Самый доступный инструмент. Аналог GZOX дешевле, но и по характеристикам немного проигрывает.

Кенгуру ICC300. EFI и очиститель карбюратора производится в Корее. Как и предыдущий образец GZOX не является средством для обхода, но тем не менее отлично справляется с такой задачей. Но открыть масляные каналы этой жидкостью не получится. Отличный вариант Для исключения ползания после длительной стоянки при пробеге колец.

Есть мнения, что хангана имеет схожий состав с голенищем, так как тоже пахнет аммиаком, но это не так. ICC300 Cleaner на водной основе и имеет хорошую эмульгирующую способность (растворимость в масле), в своем составе: оксид лаурилдетиламина, 2-бутоксиэтанол, 3-метил-3-метоксиибутанол. Заливает исключительно по температуре до 70, на результат нужно около 12 часов.

Слабо испаряется и хорошо размягчает ил. В результате проникновения в масло и непродолжительной работы двигателя после резака благоприятно сказывается на промывке масляной системы.В ожидании отложений окаменевшего лака на поршнях, чуть хуже Gzox, но цена ниже, в среднем можно купить за 400 руб. Артикул для заказа 300 мл. Ballery — 355043.

Обзоры
  • Купил кенгуру ICC 300 и решил сразу проверить его в действии. Устроил небольшой тест — брызнул на нагара на горловину масляной волны. Образовалась пена и все потекло. Теперь блестит как новая, очень удивился, что такое быстрое действие.
  • Splasgal Kangaroo ICC300 прямо у входа.Для того, чтобы помыть форсунки и клапан. Дал себя тормозить минут 10, потом начинаю потихоньку крутить кенгра, чтобы проникнуть в камеру сгорания и ждал еще минут 20. По следам я увидел много ног на ткани, но не заметил никаких изменений в двигателе.
  • Появилась небольшая детонация, после того, как Кенгуру очистил пылесос, все стабилизировалось.
  • На 200 км пробега после нарезки двигатель Kangaroo ICC300 двигатель стал заметно работать, чуть живее на разгоне и как-то легче едет.А вот с расходом масла ситуация после 2000 км усугубилась.
читать все
  • Плюсы:
  • Дешевле, чем другие хорошие режущие инструменты;
  • Один цилиндр можно очистить с помощью дроссельной заслонки и нагара на поршнях;
  • Хорошо очищает масляную систему по тому количеству, которое просачивается под кольца.
  • Минусы:
  • слабое действие при комнатной температуре.

DISTRIBUTE VERYLUBE. (HADO) Antikox относится к химическому методу удаления взвешенных в воздухе отложений нефти.Этот аэрозоль предназначен для быстрой очистки цилиндров, поршней и камер сгорания от всех видов загрязнений (нагара, кокса, лаков, смол), а также для возвращения подвижности колец бензиновых и дизельных двигателей. Но на самом деле еле справляется с чисткой поршней, не говоря уже о масляных каналах. Хандовский Антикокс намного хуже предыдущих, но если применять его на немного разогнанном моторе, то вполне заслуживает внимания. По крайней мере, в 7 случаях из 10 помогает небольшое несоответствие показателей компрессии на цилиндрах.Первый пуск после фрезера будет очень сложным.

Интересной особенностью средства VERYLUBE Antikox является то, что его можно использовать для промывки масляной системы двигателя. Поэтому производитель убеждает, что после использования не требуется замены моторного масла. Последствия после такой процедуры не изучены. Так что, учитывая масло для розжига, все же лучше заменить, как и в других случаях использования жесткого метода.

В составе моюще-диспергирующих компонентов углеводороды алифатические.Хотя это безопасно для резиновых изделий, производитель все же рекомендует избегать лакокрасочного покрытия.

Банка 250 мл. Достаточно для чистки 4-х цилиндрового двигателя Артикул такого средства — XB30033, средняя цена по Москве будет 300 р. Как показали реальные испытания, эта новинка проявляет себя. Но есть в продаже и другие комплекты, с лучшим действием, которое, кстати, позиционируется не как нарезка двигателя, а поршневые кольца. Жидкость Anticox 320 мл. на 20 цилиндров, а по факту 8-10 максимум.Код заказа — XB40011 на 600 руб. и блистер 10 мл. (Дозировка на один баллон) — XB40151 стоимостью 130 руб.

Отзывы
  • Мотор много «кушает» масло, что говорит о явных кольцах. Но выверка кулера верить ни от ХАДО положительного эффекта не дала.
  • Выполнил нарезку поршневых колец спреем Verylube Antikox согласно инструкции. В итоге при первом запуске дым был на весь двор, непонятными хлопьями выхлопа на больших оборотах.Двигатель стал работать стабильнее (исчезли мелкие сбои и холода)).
  • Сделал отсечку для профилактики. Двигатель 3.5л V6, расход масла был 300-500г на 5000км. Про пенообразование как шум или гости знали, но они дороже и не так уж и просты, поэтому потребовался очень любе антикокс, средство хоть и не самое эффективное, но рабочее и дешевое. Процедуру нанесения необходимо повторить несколько раз. Делала 2 раза, залило средство 30 минут, мне хватило 1 баллона. Результатом доволен, компрессия практически выровнялась.
читать все
  • Плюсы:
  • Есть выбор под необходимый объем;
  • Используется для очистки поршней при открытии мотора;
  • Можно сразу промыть масляную систему двигателя.
  • Минусы:
  • Слабоэффективный с надежным шифрованием;
  • Процедуру необходимо повторять несколько раз подряд.

Professional быстро, но небезопасно удаляет нагар, отмывает поршень, восстанавливает подвижность колец и может размягчать отложения в масле каналов удаления.Этот российский продукт для удаления нагара и лакового налета не соответствует международным стандартам экологической безопасности.

Coloking Greenol действует, но агрессивно. В составе химии мощные растворители, а именно селективные органические, очищенные масляные дистилляты, функциональные добавки. Владельцу авто с крашеными внутри поддон следует удерживать от его нанесения. Также пагубно сказывается масса шапки ПАВ (резинки просто набухают в 2 раза, но мы можем вернуть счастье).

Greenola будет достаточно для промывки большинства двигателей, включая V6, потому что его флакон составляет 450 мл, что намного больше, чем у большинства патронов на рынке. Мидл хедед справляется с минусом. Для достижения максимального эффекта мало выйти на прогретый мотор, это тоже до 50-80 мл сразу (или сколько будет), а в процессе испарения и просачивания добавлять.

Отзывы
  • Перед промывкой троил двигатель закинул и одну свечу маслом. На процедуру ушло полтора часа.Теперь точно работает.
  • Неделю стоял запах горелого в салоне от химии. Видимо сгорел, но это мелочь.
  • Автомобиль бросил курить. Многие меньше перестали есть мало. Компрессия поднялась и выровнялась, работает равномерно, пока минусов не нашел. Думаю сойти еще раз.
  • После пробега первых 1 тыс. Км нанесения Гринола уровень масла все еще на максимуме. А до этого расход был 300 грамм.
  • Очень мощным был горький опыт отслаивания краски и блокировки ее сетки от нефтяника: (нужно аккуратно обработать!
читать все
  • Плюсы:
  • Большого объема хватит на 3.Резка двигателя 5 литров;
  • Хорошо при использовании отдельных деталей (клапаны, цилиндры).
  • Минусы:
  • Коррозионная краска;
  • Агрессивно к резиновым деталям.

Самая популярная отечественная жидкость для снятия нагара с поршнем, его канавками и кольцами без разборки двигателя. Но как показали реальные результаты, его действие на уровне ацетона с керосином весьма посредственное. Хотя создает гораздо более агрессивную среду.

Продукт LAVR ML202 Anti Coks Fast относится к тяжелому способу резки. Это комплекс поверхностно-активных веществ и направленных растворителей различной химической природы. Создан для воздействия на смоляно-коксовые и нагаровые отложения. В ходе повторных испытаний практика показала, что после Лорел Нагар все еще остается. И полностью очистил поршень постоянно механически. Так что все заявленные производителем свойства, к сожалению, не имеют.

Рисунок Лавры однозначно требует замены масла, поэтому рекомендуем наносить ее заранее.В прилагаемой инструкции ЛАВР предусматривает 45 мл в баллонах. И буквально 30-60 минут, но такой небольшой период выдерживается исключительно для экспресс-очищения при регулярном использовании. Но при запущенном корпусе появляются веские симптомы поршней и колец, то нужно минимум 12 часов. Максимальное пребывание жидкости в цилиндре не более 24 часов. Без разбора хорошо отмывает нагар в патроннике и на рабочих поверхностях поршней. Хотя это не основная задача приложения.Самое главное срезать маслосъемные кольца. Количество жидкости рассчитано на обводку мотора объемом чуть более 2,0 л. Артикул для заказа 185 мл — LN2502.

Обзоры
  • После советов по эффективности ДИСТРИВА ЛАВРА ML-202 форум решил потестить на Шкоде с двигателем TSI. Мышелов был почти литр на тысячу. Двигатель стал работать тише, но снижение расхода масла было кратковременным.
  • Машина пробегала 150 тыс.Залил в баллоны и оставил все это живым на 10 часов, в результате эффекта почти не было. Остатки остатков побили немного, на уложенном, при прокрутке тряпкой тоже немного шламов. Машину очень хотелось завести и компрессия с 15 только до 14 упала (при 12 кгс / см2). Конечно, эндоскоп не смотрел на ситуацию изнутри, но при прошивке фонариком увидел, что поршни особо не отмыты.
  • Обкрутация, нарисованная лавровым стеклом перед заглавными буквами, показывала, что инструмент действует.
  • Пробовал лавр на Хонде. Использовал по инструкции, оставив оставил на ночь. По окончании раунда первые попытки запустить двигатель оказались безуспешными. После запуска из выхлопной трубы выпал белый дым. Плюс характерная вонь. После замены масла погонял минут 20 на скорости 120. В результате улучшилась тяга, стал легче запуск мотора.
читать все
  • Плюсы:
  • Не нужно искать инструкцию по применению, она идет в комплекте со шприцем и тюбиком.
  • Минусы:
  • Исключительно профилактический, поэтому он не эффективен при возникновении колец и потоков масла.

Чертеж Edial Это добавка к топливу, в связи с чем относится к «мягкому» способу очистки. Поэтому замену масла делать нельзя, а вот свечи менять все же рекомендуется. Инструмент предназначен для снятия автомобиля с деталей камеры сгорания.

В составе режущего агента EDIAL не содержатся щелочи, кислоты и растворители.В отличие от жидкостей, заливаемых непосредственно в цилиндры, он способен не только удалять кокс с помощью поршней и колец, но и очищать клапаны от отложений их седла, а также свечей. Препарат содержит активные реагенты и поверхностно-активные вещества (уплотнители) с огромной проникающей способностью. Но, к сожалению, ему все равно не помогает очистка колец и маслоканалов от лакового осадка.

Одна бутылка 50 мл на 40-60 литров топлива. Причем это может быть как бензин, так и дизель.Отсечка EDIAL одинаково эффективна для двух этих типов двигателей. По заявленным производителем характеристикам создает активную защиту в виде тонкой пленки на поверхности детали поршневой группы, препятствующей появлению нагара. Активация моющих присадок происходит при движении со скоростью более 60 км / ч. Приобрести можно у одного из официальных представителей продукции Edial.

  • Плюсы:
  • Замена масла после использования не требуется;
  • Очистка происходит в движении;
  • Нет необходимости соблюдать особые инструкции.
  • Минусы:
  • Исключительная профилактика не позволяет перемешивать кольца, если они сцепились;
  • Вам понадобится как минимум половина топливного бака, чтобы соответствовать инструменту и раскатывать его.

Это старый «дедовский» способ работы, который неплохо зарекомендовал себя на двигателях Ваза при советском качестве топлива и масла. Но прогресс не стоит на месте. Смесь керосина и ацетона часто улучшает масло или другие химические вещества.Как и лавровый резак, обладает «жестким» характером очистки от коксовых и лаковых образований. Для приготовления жидкости ее следует обработать из-за того, что потребуется около 150 мл на баллон. В камеру сгорания, как и другие средства такой группы, заливать в горячий двигатель небольшое количество масла улучшит эффект, оно не даст быстро испариться. Позволяет снизить расход масла, улучшить динамику, избавится от детонации, вызванной неполным сгоранием топливной смеси.

Масло необходимо заменить, так как керосин и ацетон агрессивны по отношению к маслу, поэтому после процедуры обязательно сменить смазку. При первом запуске и прогаски, на период до тех пор, пока остатки смеси и нагара не сгорят, лучше поставить старые свечи, чтобы не испортить более новые.

Коррозия керосин + ацетон «лечит» гильзу поршневых колец из-за нагара или после длительного простоя разобранного автомобиля. А еще в такой жидкости снимают детали поршневой группы при очистке от отложений при разборке мотора на капремонт.Так как чистящего средства требуется много, а цена на разделку не маленькая. Поэтому приготовить жидкость с режущими свойствами — один из лучших вариантов экономии бюджета.

Для изготовления резака из ацетона и керосина вам понадобится 250 мл. Каждый растворитель, а затем добавьте моторное масло. Пропорция смешивания 50:50:25. Итого такая смесь обойдется в 160 руб.

Когда оставался приличный пробег, оставался приличный и мотор много делал на своем пути, не лишним будет подержать двигатель.Особенно, если работа транспорта происходит в городском цикле, в условиях бесконечных пробок, при перегреве двигателя и использовании некачественного бензина.

Повышенный расход масла, при этом скорее всего машина будет дымить.

Низкая компрессия в цилиндрах (чтобы узнать это, нужно измерить компрессию).

Важно помнить, что при сильном износе деталей закругление будет бессильным. Выход в такой ситуации — ремонт.Но такой ремонт довольно дорогостоящий, потому что невозможно разделить замену только кольцами. Так как при отключении движка нужно просто просмотреть и другие узлы, а при необходимости заменить их. Более того, когда двигатель уже не новый, а разбирать только ради замены колец не рационально. И все же резчик двигателя может вам помочь, поэтому, прежде чем приступить к ремонту — попробуйте.

Для начала нужно определиться, что мы будем резать. Резак двигателя можно изготовить как специальными средствами, продаваемыми в магазине, так и средствами, приготовленными самостоятельно.

Эффективным инструментом является «Рисунок Proterra 100».

Можно по старинному дедовскому способу приготовления нужных вам средств. Керосин и ацетон смешиваем в пропорции 1: 2. Готовлю наше чудо-средство из расчета 100 — 150 мл на баллон. Это количество подбирается с расчетом на то, чтобы смесь была очень текучей. Сразу после заливки смесь будет медленно просвечиваться через кольца и стекать в картер, растворяя нагар. Но все же лучше использовать специальный инструмент, так как он более эффективен.

Начнем отрезать.

Метод остановки двигателя без ремонта:

1. Протереть двигатель до температуры не ниже 50 с

2. Снимите свечи зажигания

3. Залейте «Proterra 100 Outcasting» по 30-60 мл в каждый цилиндр

.

4. Закройте свечные отверстия тканью X / B

5. В зависимости от тактовой частоты поднять 1-4 часа, периодически проворачивая коленвал

6. Удалите с помощью свечных ямок H / B Fabric

7.Удалите остатки шприцом или продуйте сжатым воздухом

.

8. Прокрутите стартер двигателя в течение 5 секунд

9. Установить обратно снятые элементы с двигателя

10. Запустите двигатель и путь он проработает 5 минут

11. Заменить моторное масло масляным фильтром

Способ очистки поршней и колец при капитальном ремонте:

1. Снимите поршень с роликом с двигателя

2. В специально подготовленной емкости установите поршни так, чтобы верхняя часть поршня оказалась на дне резервуара.

3.Залить «Proterra 100 cutoff» в емкость так, чтобы жидкость закрывала очищающую поверхность поршней вместе с кольцами

.

4. Закройте емкость крышкой или полиэтиленовой пленкой

5. Удерживать поршни на 30-60 мин.

6. Снимите поршни и удалите ослабленный нагар с помощью жесткой щетки и пластикового шпателя

.

7. Протрите деталь чистой тряпкой

8. Остатки загрязнений в каналах компрессионных и маслосемянных колец очистить жесткой неметаллической щеткой и инструментом «Протерра 100», предотвращающим высыхание препарата на поверхности поршня

9.Очищенный поршень Промойте большим количеством горячей воды, затем продуйте сжатым воздухом и смажьте моторным маслом

1. Результат можно улучшить, если перед п.2 нагреть поршень горячей воды

2. При очистке поршней с тефлоновым покрытием допускается разбавление препарата водой, но не более 1/3

После всех работ результат не заставит себя ждать. В результате у нас должно получиться следующее:

  • усиление и выравнивание компрессии во всех цилиндрах
  • восстановление былой мощности и динамики двигателя
  • снижение токсичности выхлопных газов
  • улучшение запуска холодного двигателя
  • снижение форсированного расхода масла

В завершение я хотел бы напомнить вам, что всех этих результатов мы добьемся только при условии, что все износы цилиндрофонной группы в норме.

»Самостоятельно нарезать двигатель

Резчик двигателя — кому он нужен

Все водители условно разделены на 2 категории: в первую входят те, кто с прямыми руками и знает, что такое «облавочный» двигатель сам по себе и для чего он необходим; Те водители, которые относятся ко второй категории, скорее всего, даже не слышали об этом.

Резчик двигателя — одна из неотъемлемых составляющих ремонта вашего автомобиля.Еще одна причина проведения этого процесса заключается в том, что в итоге вы увеличите пробег до капремонта. Поэтому, если вы давно сами ремонтируете свою машину и не доверяете сотне, то наверняка знакомы с этим понятием.

Скорее всего, если ваша машина относится к дорогим моделям зарубежных производителей, то вы никогда не задумывались о таком понятии, как резка. Возможно, вы привыкли просто передавать свою машину специалистам, а потом оплачивать их услуги.

Эта статья ориентирована на тех, кто не может позволить себе такое обслуживание.

Видео с чертежами двигателя

Что такое резка двигателя?

Под этим определением подразумевается процесс удаления отложений в виде автомобиля или кокса в двигателе. Образования таких отложений не избежать, ведь это естественный процесс, когда мотор работает через определенные промежутки времени.

Всем известно, что двигатель внутреннего сгорания функционирует за счет использования в своей работе горюче-смазочных материалов, которые чаще всего представлены бензином и маслом.Именно эти ГСМ являются источниками отложений. К ним относятся нефть, бензин и дизельное топливо.

Основные причины кода двигателя

Основными источниками фокусировки двигателя являются масло и топливо.

Мало может проникнуть в камеру сгорания через небольшие зазоры в маслоподающих кольцах. Таким образом, масло попадает в камеру сгорания, оседает на цилиндрах и поршнях, где под воздействием высоких температур через некоторое время покрывается. Скорость процесса образования отложений влияет на то, насколько новым будет масло и мотор автомобиля.

В свою очередь топливо попадает в камеру сгорания через штоки впускных клапанов — оно падает при всасывании топливно-воздушной смеси поршнем в цилиндрах. При таком способе в двигатель попадает лишь небольшое количество топлива, но со временем оно также забивается и влияет на работу двигателя.

Двигатель с пробегом

В начале статьи мы рассмотрели проектирование нового двигателя. Но если вы — владелец автомобиля, пробег которого составляет 90 000–100 000 километров, то не только изношенные маслосъемные кольца — это вся цилиндрическая группа.Таким образом, скорость образования кокса становится намного выше.

По такому же принципу действует газораспределительный механизм. В основном первые симптомы сфокусированного двигателя — это дым с особым запахом и скрежет свечей зажигания. В этом случае нужно как можно быстрее сделать двигатель.

Чтобы достоверно выяснить причину, необходимо задуматься о таких факторах:

  1. Если расход масла превышает 300 грамм на 1000 км пробега; При этом величина пробега автомобиля отечественного производства не превышает 100 тысяч километров, а зарубежного — 200 тысяч.
  2. Если при осмотре авто вы обнаружите на резьбе свечей масло или при резке пеница дымит выхлопная труба, это верный признак того, что безмасляные колпачки пропускают масло.

Крышки Occupatic не подлежат ремонту — их нужно только заменить. Но если вы делаете это впервые, лучше, если вы будете под контролем специалиста.

Есть и другие признаки фокусировки двигателя:

  1. Двигатель часто перегревается.
  2. Мотор часто работает на холостом ходу.
  3. Эксплуатация автомобиля только в городском цикле.
  4. Использовать некачественное или не подходящее для моторного масла моторное масло.
  5. Длительная стоянка автомобиля (зимой, после ДТП, длительного ремонта и тд).

Цилиндропиональная группа

Рассмотрим подробнее цилиндропионную группу.

Если у вашего автомобиля изношена цилиндропионная группа, то у вас всего 2 варианта: первый вариант — это капитальный ремонт двигателей с полной заменой колец, поршней и так далее.Второй вариант — провести резку двигателя — после этого ваш двигатель сможет «пробежать» еще 50000, 60 000 или даже 70 000 километров. На эту величину влияет степень износа двигателя.

Обязательно делать отсечку?

Если коротко ответите, то нет. Но если вы этого не сделаете, то двигателю вашего автомобиля придется сделать капитальный ремонт.

В свою очередь закругление очищает поршни, цилиндры и другие детали цилиндрической группы от кокса и нагара.Поскольку наиболее важными деталями в этой группе, кроме поршня, являются еще и компрессионные и смазочные кольца, там тоже стоит провести тщательный обходной круг.

При этом не забываем про пазы под эти кольца. Почему? Потому что нагар, который в них образуется, со временем «вырастает» до такого уровня, что кольца не смогут плотно лежать на своем месте, что в свою очередь приведет к менее качественному удалению масла со стенок корпуса. цилиндр, а от и может прилипнуть.

Чем больше моторного масла поступает в камеру сгорания, тем больше кокса образуется в цилиндре, который ведет к кольцам. Таким образом, если вы все-таки не можете провести капитальный ремонт двигателя, но хотите продлить срок службы, то процесс укладки является обязательным.

Запускаем двигатель допуск

Мы рассмотрим два способа резания двигателя.

Первый способ подразумевает использование химического состава для смягчения и дальнейшего удаления нагара.Этот химический состав должен проливаться через свечи зажигания или в сети. Это очень эффективный метод в том случае, если кольца полностью покрыты нагаром и запустить двигатель практически невозможно. Перед тем, как начать резку двигателя, рекомендуется измерить компрессию.

Резак двигателя первым способом:

  1. Зачистите двигатель до 70-90 градусов.
  2. Снимите свечи зажигания или, в случае дизельного двигателя, форсунки.
  3. Подчеркните колеса и поставьте на них «башмаки».
  4. Перейти к последней передаче.
  5. Поверните ведущее колесо, пока поршни не окажутся примерно в среднем положении (для этого можно использовать длинную отвертку).
  6. В зависимости от объема цилиндра для выемки двигателя положить 25-80 миллилитров специального химического состава.
  7. Установите свечу зажигания обратно или форсунку.
  8. Подождите 1-2 часа. В этот период произойдет химическая реакция, которая разложит нагар. Для повышения качества этого процесса необходимо каждые 20 минут поворачивать ведущее колесо вправо и влево на 15 градусов, выполняя при этом 5 сторон в каждую сторону.Таким образом, вы способствуете лучшему попаданию жидкости в кольца. Если хотите добиться максимального результата, можете оставить машину на всю ночь.
  9. Снимите свечи зажигания или форсунки.
  10. Прокачайте оставшуюся в цилиндрах грязную жидкость (например, с помощью шприца).
  11. Отсоедините систему зажигания.
  12. Еще раз проверьте, выдвинуты ли колеса и включена ли последняя передача.
  13. Проверните двигатель стартером на 10 секунд — таким образом вы избавитесь от оставшейся жидкости.
  14. Установить зажигание и форсунку свечей, подключить систему зажигания и завести автомобиль.

Поначалу машину будет очень сложно завести. Также не стоит думать о неприятном запахе выхлопной трубы — это совершенно нормально. Поработайте в таком режиме 10 минут, а затем извергните. Первые 20 километров после поездки будет подсвечен едким дымом. После такого небольшого «пробега» необходимо заменить свечи зажигания на новые. Через следующие 40-50 километров необходимо в обязательном порядке заменить моторное масло, так как старое негативно скажется на эксплуатационных показателях автомобиля.Следующий этап проверки наступит через 300 километров — нужно еще раз замерить компрессию двигателя и сравнить текущие показатели с прошлыми. Самое главное — отсутствие большой разницы в показателях цилиндра.

Основными недостатками этого метода являются большие траты средств, связанные с покупкой моторного масла и новой свечи зажигания. Другой риск — это кольца Lopanie Rings — это происходит, если кольца были очень синхронизированы. Кроме того, вы теряете много драгоценного времени.

Есть еще второй путь , с помощью которого можно потренировать двигатель.Его основные преимущества — более низкие затраты на рабочую силу, меньшая финансовая стоимость и не любой ценой.

Принцип этого метода — постепенное добавление специальных присадок в топливо или моторное масло. Впоследствии эти химические элементы повлияют на целевые области вашего двигателя. Если вы решили добавить их в моторное масло, лучше всего это сделать во время его замены — вы продвинете масляную систему, и вместе с новым маслом в двигателе появятся специальные присадки. Также можно залить этот препарат прямо в топливный бак, при этом сам режим работы никак не изменится.Еще раз подчеркнем преимущества второго способа:

  1. Не нужно менять моторное масло.
  2. Также нет необходимости заменять свечи зажигания или форсунки.
  3. Значительная экономия времени.

Еще одним важным фактором является постепенная резка мотора . Таким образом снимается нагар на маслосъемных кольцах, в их посадочных местах, на клапанах, свечах и даже на катализаторе. Единственный недостаток этого метода — после такой отсечки необходимо промывать топливную систему специальными средствами.

Как проверить свечи зажигания своими руками
Ignition Pass — Поиск Pass Катушка зажигания Peugeot — замена на разные модели
Как поменять масло в двигателе своими руками Как проверить уровень масла в АКПП — советы и рекомендации

Жизнь автомобиля с человеческим не сравнить. Простая арифметика: на холостом ходу дизельный двигатель делает минимум 600 оборотов в минуту, то есть 10 оборотов в секунду. При этом поршень «идет» 20 раз.Пресс газовый — количество оборотов больше тысячи. Добавьте сюда постоянное воздействие высоких температур и холода при запуске зимой … Такой экстремальный человек даже не мечтал! Поэтому забудьте о такой процедуре, как резка двигателя при разработке LAVR ML202 — ML203 Novator и о настоящем преступлении.

История вопроса

Когда автомобили только появлялись в СССР, все знали, что периодически нужно очищать поршневые кольца от загрязнений. Топливо тогда горело намного хуже, чем сейчас.На поверхности деталей быстро образуются лаки и шлам.

Масло тоже было так себе и даже хуже. Что с ним случилось в двигателе? Он окислился на стенках цилиндров, превратившись в пленку, и попал в канавки поршней. Также в процессе сгорания топлива образовывалась сажа, которая перемешивалась масляной пленкой. Со временем все это превратилось в единый монолит — стойкие твердые отложения, блокирующие работу поршневых колец.

С загрязнителями советские автомобилисты боролись всеми доступными способами: залили двигатель керосином на ночь, растворители стали добавлять позже.Отчаявшиеся автомобилисты не остановили риск вообще остаться без автомобиля и практически нулевую эффективность подобных составов. Однако теперь владельцы «Железных лошадей» не склонны экспериментировать во вред себе. А некоторые вообще забыли про резку двигателя — расслабились, сделав ставку на присадки в современные масла и условно высокие стандарты топлива.

С тех пор современная автохимия в лице наших препаратов МЛ202 — МЛ203 Новатор шагнула далеко вперед. Тем не менее, как некоторые думают, она все еще не исчерпывающая.Поэтому мы решили развенчать самые популярные мифы о резке двигателя.

Миф 1. Современные двигатели не нужны

Ничего подобного! Конечно, за 10-15 лет ситуация с топливом и маслом изменилась в лучшую сторону. В советское время без паяльной лампы зимой не заводилась (по умолчанию, как опасно греть поддон смазочной системы: малейший подтекст, а от «Жигуля» остались сгоревшие ножки да рожки), и теперь легкий холодный запуск — это нечто Разрешенное.

Несмотря на это проблема с синхронизацией никуда не делась и даже обострилась. Благодаря прогрессу: технология идеальна, зазоры между поршневыми кольцами и канавками меньше, система уязвима. Даже тонкий слой отложений приводит к тому, что работа двигателя нарушается. Со временем отложений становится больше, проблемы становятся серьезнее — падение компрессии, качение зажигания, детонация, ускоренный износ, а затем и серьезная поломка. За капремонт ругать не захочется — про обрезку не забываем.

Миф 2. Резка двигателя — универсальное лекарство от всех

Бесспорно, о препаратах ЛАВР ходят практически легенды. Но до «живой воды» от народных сказок им далеко. Резка двигателя — в первую очередь ремонт и профилактика. Как осмотр врача-гигиениста, если проводить параллели с лекарством. Если есть проблемы с чистотой в цилиндрах ML202 и 203, их устранят. Но если двигатель сильно изношен, никакие процедуры, кроме переборки и замены деталей, система не поможет.

Миф 3. Процедура рисования для всех двигателей одинакова

Принцип один для всех двигателей. Однако двигатели разные — рядные, супротивные, V-образные … у каждого есть свои нюансы. Если вы сильно сомневаетесь, уточните их у наших специалистов по телефону или электронной почте. Но общее правило одно: если у двигателя есть цилиндр под наклоном, лучше налить в них больше жидкости. Подробная информация о нарезке встречных и V-образных двигателей,

Миф 4.Постоянно использую присадки к бензину и промывку форсунок жидкостью с режущим эффектом. Сделайте еще что-нибудь вырезать

Наиболее эффективно удалить отложения можно «методом погружения» — то есть заливкой режущего состава непосредственно в цилиндры. Так что не мешает одно. Но при этом есть нюансы: не всегда просто довести до технологических ям — нужны специальные инструменты и комфортные условия. На улице, в дождь или снегопад эту процедуру лучше не проводить.Именно поэтому советуем совмещать тренировку двигателя с плановой заменой масла или свечей.

Миф 5. Чем больше жидкости для резки, тем лучше очищаются цилиндры.

Жидкости должно быть достаточно, чтобы поршни были хорошо увлажнены. Объем препаратов рассчитан таким образом, чтобы фрезы хватало на обработку всех цилиндров. 50-60 мл сверх желаемого объема двигателя не повредит, но и ведра с лекарством тоже не стоит.

Миф 6. Жидкость для рисования должна очищать

Наши препараты — для тех, у кого средняя и высшая степень баллона. Часто бывает, что в старых наплавках двигатели «держат» детали, так как цементный раствор скрепляет кирпичи. Поэтому чистить такие системы не рекомендуется. Кроме того, слишком большое количество раствора может повредить детали двигателя. Тем не менее, наши составы намного прочнее многих аналогов и традиционных растворителей.

Миф 7. После распила машина всегда сильно дымит

Автомобиль будет дымить в любом случае, но не всегда сильно.На поршне есть технологические выемки, в которых задерживается жидкость. Кроме того, отложения пропитываются парами препарата и набухают, не давая жидкости вытекать дальше. Эти лишние лекарства начинают гореть при запуске двигателя после процедуры, превращаясь в белый дым из выхлопной трубы.

Чтобы курить меньше, рекомендуем удалить оставшуюся в цилиндрах жидкость. Это можно сделать с помощью тюбика со шприцем, который идет в комплекте с препаратом.При необходимости его можно удлинить любой пластиковой трубкой. Даже если жидкость не откачивается, запуск может быть затруднен, а густой белый дым будет длиться дольше. За катализатор переживать не стоит — препарат мигает постепенно и не вредит ему.

Миф 8. После отрезания кнопки можно попасть в автосервис и заменить там масло

В принципе можно. Но однозначный ответ на этот вопрос зависит от того, сколько масла у вас в системе, какого оно качества, сколько нужно идти в автосервис, с какой скоростью, какой будет нагрузка на машину и т. Д.и т. д. Поэтому рекомендуем менять масло, не отходя от кассы — то есть сразу после резки, и не уходить в рискованные плавания.

Миф 9. После распила будет только хуже, так как в цилиндрах падает компрессия

Как правило, старые двигатели буквально перекрывают друг друга. Из-за этого сильно изнашиваются поршни и кольца. Если подержать каракатицу на этой машине, то окажется, что за годы эксплуатации детали изрядно потрепались.Поэтому компрессия падает, и запуск становится затруднительным. Если обработка двигателя препаратами новатор ML202 — ML203 не дала хороших результатов, значит двигатель пора на переборку.

Миф 10. После процедуры двигатель не заводится

При резке двигателя цилиндры смачиваются жидкостью. Если они не должны их сушить, мотор может запуститься не с первого раза, а только после нескольких попыток. Поэтому после процедуры рекомендуется протереть свечи насухо и удалить излишки препарата с баллонов.

А иногда дело вовсе не в процедуре резки. Бывает, что процедура проводилась с помощью нашего препарата по всем правилам. Но машина никогда не заводится. Оказывается, на машине есть катушки высокого напряжения. Если вернуть их на места, двигатель заведется с пол-оборота!

Именно поэтому мы настаиваем на том, чтобы строго следовать инструкциям. Да и фраза о том, что автомобилист, решаясь на процедуру, должен обладать элементарными навыками в обслуживании двигателя, тоже не на коробке ДТП.Так что будьте внимательны, следуйте рекомендациям специалистов, и тогда ваш двигатель окупит вас тихой и безупречной работой!

Определенно хороши двигатели

EP6, в которых реализованы лучшие разработки «яйцеголовых» инженеров BMW и PSA. Однако, как это не удивительно, у многих даже совсем «молодых» Peugeot и Citroen Motors EP6 работают нестабильно и шумно, не развивают мощность, «забивают» при разгоне, потребляют слишком много топлива и масла. После относительно небольшого пробега, фаз синхронизации «Работа» на приборной панели загорается ошибка «Неисправна система защиты от загрязнений»… Практически в новой машине датчик температуры охлаждающей жидкости может «превратиться в некорректную работу мотора и замену термостата. Частые течи масла добавляют их дымоход. Основные потенциально опасные места — прокладка клапанной крышки (особенно если масло течет. в свечи и разъедающие наконечники катушек зажигания) и корпус масляного фильтра, прокладка вакуумного насоса, электроклапана масляного насоса.

При редкой замене масла и особенно при работе двигателя ЭП6 с пониженным уровнем масла выходит из строя механизм подъемных клапанов.Возможны варианты. Либо «закрывает» сам двигатель, который приводит в движение подъемный вал клапана, либо червячная пара двигателя с валом механически изнашивается. Посмотрите на фото, как выглядит механический износ червячной передачи и шестерни вала подъемного вала клапана.

EP6 PEUGEOT 308 Worm Drive Worm Drive Motor Warm Drive, обратите внимание на толщину зубьев посередине

Ep6 Подъем клапана двигателя Двигатель подъемного механизма клапана 308, в середине зубчатого колеса «Пропиленовая» дорожка

Небольшой ресурс имеет однорядную цепочку синхронизации.Она просто тянется. Добавьте сюда рекомендованную французской заменой масла после 20 000 километров пробега и уже в конце гарантийного срока вы получите затоптанный черным веществом двигатель и смещение фаз. Шлаки от редко меняющихся масляных каналов в ЦБК и клапанов фазорегуляторов, которые подаются на регуляторы масла. Сами фазорегуляторы могут пострадать от нефтяного шлака. На двигателях первых выпусков металлические уплотнительные кольца распределительных валов «пропили» дорожки на постелях распределительных валов, из-за чего необходимое давление масла на фазорегуляторы не подается.Двигатель начинает «богатеть» и появляется ошибка P2178. Об этом поподробнее.

Ошибка P2178, указывающая на чрезмерно обогащенную смесь, может появиться по многим причинам. Но в основном это, конечно, загрязнение нефтяных каналов CHC.

Клапаны ЭП6 покрыты толстым нагаром, особенно на. Это связано, в первую очередь, с быстрым износом маслоспускных колпачков, особенно на выпускных клапанах. Выпускные клапаны крепче колпачков на них быстрее. Масло летит в цилиндры, продукты его сгорания оседают жирными черными наростами на клапанах, катализатор преждевременен.Нагар затрудняет работу клапанов и ухудшает газораспределение, но также дополнительно «нася» и без того плохие безмасляные колпачки, из-за которых последние полностью перестают выполнять свою функцию. Для устранения нагара на клапанах необходимо действовать резко, очищая клапан вручную. Пока процесс не зашел так далеко, можно профилактически. Стоит не особо дорого и нужно делать, если ваш ЕР6 пробег более 50 тысяч и начало потеть маслом. Расход масла обычно связан с поломкой мембраны маслоотделителя, который находится в крышке клапана.В этом случае не стоит морочиться с китайскими ремкомплектами, они просто ужасного качества, но лучше весь чехол «помахать». У нас всегда есть оригинал. Еще одна проблема турбоагрегатов ЭП6ДТ — забитые все те же отложения старой масляной трубки, по которой масло подается на турбину. Когда масло перестает поступать к турбине, оно «накрывается».

Что касается проблем с фазами GDM, в первую очередь необходимо правильно определить источник проблемы. А потом либо с натяжителем и успокаивающими средствами, либо заменой «звездочек» фазорегуляторов распредвалов или клапанов, подающих на них масло, либо прочисткой маслоканалов в ЦБК, либо сразу всем перечисленным.«Пить кровь» еще может механизм подъемных клапанов или изношенная ложе распредвалов. Стоит отметить, что в мультибрендовом сервисе вас вряд ли наладят или отрегулируют моторы EP6 и EP6DT. Практически любое вмешательство в двигатель требует последующей адаптации с помощью компьютера и специализированного программного обеспечения. Лексия есть далеко не в каждом автосервисе. Еще меньше людей, которые могут его нормально использовать.

Конечно, прежде всего нужно элементарно проверить уровень масла! Двигатель EP6 из-за своей сложной системы GDM очень чувствителен к уровню масла и «колбасе», если не хватает «всего литра».Чаще всего фаза ГРМ смещается просто из-за натянутой цепи. Ничего удивительного. На самой цепи без разрывов не увидишь, такое впечатление, что она предназначена для велосипеда «Friendly». Не удалось поставить хотя бы двухрядный … Для моторов EP6 самое страшное — это редкая замена моторного масла, широко практикуемая в автосалонах. Сердце истекает кровью, когда к нам приезжает какая-то симпатичная девушка на Пежо 308, которую провели дилеры, сервисная книжка которой аккуратно заполнена, но при этом сливается не просто выхлопное масло, а 2-3 литра. из густых черных веществ, больше напоминающих мазут… Возможно, масло вообще не меняли. Или меняли каждый раз.

Наш скромный вид, 10 000 километров — предел ресурса моторного масла, каким бы хорошим оно ни было. С точки зрения езды по московским пробкам масло желательно поменять вообще тысяч через 8 пробега. Не реже одного раза в год нужно менять свечи. Есть масса живых примеров, когда люди «забивали» по гарантии и самостоятельно меняли масло. Один наш дедушка-клиент на 308-м пыжике, занимался заменой масла в собственном гараже по старой привычке, проехал при этом 170 тысяч, и, что удивительно, его мотор до сих пор работает как часы!

Вывод из вышесказанного напрашивается простой.

Добавить комментарий

Ваш адрес email не будет опубликован.