2110 ремонт порогов: 2110, 2111, 2112 | , , ,

Содержание

Замена порогов ВАЗ 2110 своими руками с видео и фото

Ремонт и обслуживание

Автор Алексей Степанов На чтение 5 мин. Просмотров 5.6k. Опубликовано

Замена порогов на ВАЗ 2110 — это ещё одна процедура, с которой однажды придётся иметь дело каждому автовладельцу. Сделать это можно в автосервисе, а можно и своими силами, просмотрев видео-инструкции. О том, как заменить пороги своими руками, мы и поговорим в этой статье.

Почему и когда надо поменять пороги на ВАЗ 2110

Всё просто: со временем они ржавеют и разрушаются. Днище и пороги на ВАЗ 2110 подвержены коррозии. Даже если автомобиль новый, через 8-10 лет пороги на нём будут изъедены ржавчиной. Причины очевидны: именно эта часть автомобиля сильнее всего подвергается воздействию влаги и других агрессивных факторов окружающей среды, таких как реагенты, которыми в гололёд посыпают дороги

. Нельзя исключать и механические повреждения: удары, царапины вначале приводят к вмятинам и сколам краски на порогах, а затем возникает и ржавчина. В этих случаях необходимость поменять их становится очевидной.

Инструменты и материалы

Перед тем как менять пороги, следует запастись некотрыми важными инструментами и материалами.

  1. 3 диска для болгарки.
  2. 1 диск для чистки.
  3. 1 жёсткая металлическая щётка для болгарки.
  4. Комплект новых порогов, усилителей и соединителей для автомобиля ВАЗ 2110.
  5. Фрагмент днища от ВАЗ 2110 размером 50Х50 см (для вырезания заплат).
  6. Упаковка автомобильной мастики.
  7. 2 малярных кисточки средних размеров.
  8. Банка грунтовки.
  9. Бутылка растворителя.
  10. Комплект торцовых и рожковых ключей.
  11. Болгарка.
  12. Электродрель.
  13. Сварочный автомат (на 220 В).

Как заменить своими руками (пошагово с фото)

  1. Автомобиль устанавливается на эстакаду.
  2. Производится визуальный осмотр днища и порогов. Выявляются места максимальной коррозии, а также места, которые ещё могут быть отреставрированы путём рихтовки, грунтования и покраски. Необходимо помнить: чем больше площадь повреждённых участков, тем больше потребуется материала и усилий на их починку.

    Насквозь проржавевший порог ВАЗ 2110

  3. После выяснения площади повреждения порогов с автомобиля снимаются передние и задние двери.
  4. Как только двери сняты, снимается порог из алюминия (находится он под дверными уплотнителями). Низ дверных уплотнителей тоже снимается, коврики из салона следует убрать или поднять максимально высоко, чтобы они не мешали дальнейшей работе.
  5. Намечаются линии среза старых порогов. По этим линиям высверливается ряд отверстий диаметром не менее 4 мм, находящихся на расстоянии 5-8 см друг от друга.
  6. Проржавевшие пороги срезаются с помощью болгарки. Болгарка должна идти точно по линиям с ранее высверленными отверстиями (это значительно облегчает процесс резки). Как правило, первым делом срезаются пороги передних дверей, потом пороги дверей задних, а затем удаляется участок в районе средней стойки кабины.

    Пороги с ВАЗ 2110 срезаются болгаркой

  7. Срезая наружную панель порогов, следует обязательно оставить участки металла у переднего и заднего крыла. Длина этих участков — не менее 5 см, именно к ним позднее будет приварена новая панель. Также следует оставить небольшой участок металла под средней стойкой.

    Участок металла, оставленный под средней стойкой ВАЗ 2110

  8. Снимается усилитель порогов.
  9. Освободившееся место с помощью металлической щётки, установленной на болгарку, тщательно очищается от грязи и ржавчины. Если где-то остались небольшие проржавевшие участки, они вырезаются. Места, в которых будет производиться сварка, следует зачистить особенно тщательно.
  10. Новый соединитель приваривается к усилителю подрамника, как правило, внахлёст. Нижний край усилителя и соединителя выравнивается.

    К подрамнику приварен новый соединитель

  11. Наружная панель подгоняется к соединителю как можно точнее. При необходимости выемки в ней следует расширить для максимально точной подгонки панели по месту.

    Подгоняется наружная панель порогов

  12. Окончательно подогнанная панель крепится струбцинами.
  13. После этого соединитель следует приварить к днищу кузова.

    Днище ВАЗ 2110 с приваренным новым соединителем

  14. Затем, не ослабляя струбцин, следует приварить верхнюю часть порога.

    Полностью приваренный порог ВАЗ 2110

  15. Все швы, оставшиеся после сварки, необходимо тщательно зачистить, прошпаклевать, проверить на герметичность, загрунтовать и покрасить.

Видео: как произвести замену самому

Важные моменты

  • Все работы по замене порогов следует производить, установив машину на ровную площадку, без перекосов.
  • Прежде чем приваривать верхний край новых порогов, нужно обязательно попробовать самому повесить двери на машину. Нередки случаи, когда двери после сварки либо закрываются с трудом, либо не закрываются вообще. И произойти это может из-за одного незначительного перекоса порогов, заметить который невооружённым глазом удаётся далеко не всегда.
  • Никогда не следует экономить на антикоррозийной обработке порогов. Если её не провести, вся проделанная работа пойдёт насмарку уже через несколько лет.
  • Очищать пороги от ржавчины и грязи лучше всего с помощью растворителя. Работая с ним, нужно соблюдать правила техники безопасности: пользоваться перчатками, надевать защитные очки (это особенно актуально, если приходится обрабатывать днище машины, стоя под эстакадой — капли растворителя могут легко попасть в глаза), а сам растворитель наносить только малярной кистью.
  • Перед привариванием порогов на участках металла, к которым планируется прикрепить порог, обязательно следует просверлить ряд отверстий диаметром не менее 3 мм. Это значительно облегчит процесс точечной сварки, а порог будет держаться крече.

Главное при замене порогов — аккуратность и внимание. Очень важно вырезать весь ржавый и повреждённый металл как на днище, так и на порогах. Если останется хотя бы один небольшой участок ржавчины, разрушение конструкции начнётся снова. И, конечно, антикоррозийная обработка при замене порогов обязательна.

Копирайтер с пятилетним стажем. Оцените статью: Поделитесь с друзьями!

Замена порогов ВАЗ/УАЗ в Самаре. Цена/стоимость, фото, отзывы

 

Замена порогов ВАЗ/УАЗ

Всем хорошо известно — первое в автомобиле, что начинает покрываться слоем коррозии — это пороги. Причина этого явления — время, даже, если с завода пороги покрыты слоем хрома или защитной краской, все равно пороги дают о себе знать раньше всего остального, поскольку они чаще всего оказываются в контакте с ногами, влагой и грязью.

Сложности, связанные с порогами

Условно, специалисты нашего сервиса различают следующие проблемы, которые возникают у порогов автомобилей марки ВАЗ и УАЗ:

  • наличие вмятин — особенно это актуально для относительно новых авто;
  • ржавчина и слой коррозии;
  • нарушение основных прочностных характеристик.

Множество автолюбителей предпочитает ремонтировать пороги самостоятельно либо обращаются за помощью к знакомым, которые не имеют достаточной квалификации. В результате новый порог не достаточно ровно или прочно держится на крепежах, а отремонтированный порог может содержать не очень эстетичные сварные швы и портить общий вид авто. Из факторов, которые крайне негативно влияют на пороги вашего автомобиля, следует отметить следующие:

  • ржавчина и коррозия из-за влияния атмосферы, грязи, дорожной химии или просто в силу возраста авто;
  • крайне низкое качество состава металлического сплава, из которого выполнен порог;
  • дорожно-транспортные происшествия, которые привели к деформации и разрушению порогов;
  • постоянная вибрация двигателя и колес;
  • столкновение с низкими барьерами и препятствиями.

Наши преимущества

Проводя замену порога автомобиля марки ВАЗ или УАЗ на старые крепежи или выполняя ремонт порогов, необходимо помнить о квалификации сварщика. Если вы желаете заменить порог качественно или провести недорогие, но высококвалифицированные услуги по ремонту порога вашего ВАЗ или УАЗ, обращайтесь к нам. Звоните и вы удивитесь тому, насколько доступными могут быть услуги профессиональных автомехаников. Замена или ремонт порога начинается с тщательного осмотра повреждений и дальнейшими консультациями касательно ремонта порога или его замены. Сварочные работы проводятся на самом высоком уровне, мы оставляем зачищенные, отполированные и эстетически незаметные сварные швы, после которых ваш автомобиль будет выглядеть как новый.

Почему стоит обратиться к нам?

Замена порога автомобилей ВАЗ и УАЗ — одна из тех услуг, которую оказывают наши мастера почти каждый день. Огромный опыт, знания всех «подводных камней», возникающих в процессе ремонта — плюс в качественном и недорогом ремонте порог вашего авто. В случае если порог полностью прогнил, мы быстро и на высшем уровне готовы предложить вам замену порога, либо его усилителя. Звоните, мы позаботимся о вашем автомобиле.

Ремонт днища ВАЗ 2110 своими руками

Кузов автомобиля с годами подвергается коррозии, особенно быстро он начинает ржаветь, если за ним не ухаживать, не делать антикоррозийное покрытие. Насколько скоро начинают покрываться ржавчиной кузовные детали, также во многом зависит от качества железа, заводской обработки, со временем автомобилю требуется ремонт днища, порогов, лонжеронов, колесных арок и так далее.

Проржавевшие пороги и гнилое днище – достаточно часто встречающаяся проблема на авто ВАЗ-2110, а так как подобная работа в автосервисе стоит достаточно дорого, многие автовладельцы стараются отремонтировать машину своими руками. Залатать дыры на кузове и привести авто в нормальный вид самостоятельно можно различными методами, есть бессварочные способы, но в основном все собственники машин стараются произвести ремонт с использованием сварки.

Ремонт днища ВАЗ-2110 без сварки

При любом кузовном ремонте в первую очередь необходимо произвести внешний осмотр железа, выявить и отметить для себя, какие участки находятся в плачевном состоянии, нуждаются в ремонте или замене. Состояние металла днища определяется разными способами:

  • при помощи молотка и керна – если вы считаете, что на определенном участке присутствует ржавчина, необходимо несильно ударить по металлу, проверить, нет ли под антикоррозийным покрытием гнилого железа;
  • попробовать поднять машину на домкрате с каждой стороны – если упорные площадки подгнили, при попытке поддомкратить авто это будет заметно;
  • понажимать в разных местах на пол автомобиля – слабое, подгнившее железо будет прогибаться под ногами;
  • попытаться передвигать взад-вперед передние кресла в салоне – проблематичное перемещение сидений также нередко говорит о плохом состоянии металла.

Любой ремонт порогов и днища бессварочным способом не является профессиональным, и мастерами считается только временной мерой, чтобы по-хорошему восстановить состояние кузова, без сварочного аппарата не обойтись. Ремонтируя днище без сварки, заплатки и новые кузовные элементы не вваривают, а устанавливают на заклепках или саморезах (болтах), подготовка и вся другая работа производится так же, как и при традиционном ремонте кузова с использованием сварочного аппарата.

Инструменты и материалы для ремонта днища автомобиля

Прежде чем приступать к восстановлению кузова традиционным способом (с использованием сварки), необходимо приготовить все самое необходимое, из инструментов вам понадобится:

  • сварочный аппарат;
  • болгарка;
  • электродрель со сверлами;
  • отвертки;
  • молоток.

Для удаления старой шумоизоляции может потребоваться зубило, быстрее и эффективнее удалить «шумку» можно с помощью перфоратора. Для зачистки металла нужна наждачная бумага различной зернистости, для повышения производительности работ рекомендуется использовать зачистную машинку. Без материалов при ремонте днища также не обойтись, здесь многое зависит от объема восстановительных работ. Чаще всего приходится использовать:

  • заплатки (куски нового железа) или готовые запасные части, например, лонжероны пола, панели, усилители порогов и т. д.;
  • грунт;
  • преобразователь ржавчины;
  • антикоррозийные и шумоизоляционные материалы (можно использовать Мовиль, Тектил, битумную мастику, Dinitrol, Прим Антишум и проч.).

Так как тормозные, топливные трубки под днищем нередко основательно ржавеют, прикипают и не отворачиваются, во многих случаях они также требуют замены.

Подготовительные работы

Прежде чем установить новые зарплаты на днище или вварить элементы кузова, нужно произвести подготовку, частично разобрать автомобиль:

  • снять сиденья;
  • удалить ковролин;
  • демонтировать старую шумоизоляцию;
  • убрать в сторону электропроводку в тех местах, где будет проводиться ремонт.

Перед заменой отдельных элементов, установкой заплаток вся металлическая поверхность освобождается от старой шумоизоляции, тщательно вымывается и вытирается, зачищается с помощью болгарки, зачистной машинки или наждачной бумаги. Затем металл следует обезжирить и обработать преобразователем ржавчины, только после этого можно приступать к непосредственной работе с железом.

Замена элементов днища автомобиля

Чаще всего при замене отдельных деталей днища или установке заплаток используют сварку, лучше всего для подобного ремонта подходит сварочный полуавтомат. Если меняется целиком отдельная деталь, например, поперечина, здесь можно высверлить заклепки и демонтировать элемент без применения сварки.

Когда одновременно меняется днище и пороги, последние снимаются с машины в первую очередь, и при замене порогов важно контролировать геометрию кузова. При замене напольных панелей части днища всегда монтируются снизу, затем прихватываются сваркой или устанавливаются на заклепках. Когда в полу кузова имеется множество дыр и очагов коррозии, лучше заменить днище полностью, тем более, в сборе оно на «Десятку» стоит относительно недорого.

Завершающие этапы при работе с днищем

После проведения работ по восстановлению днища кузова необходимо обработать поверхность антикоррозийными составами, лучше всего железо сначала загрунтовать, а затем уже нанести антикор. Перед нанесением защитного слоя металл обязательно нужно тщательно отмыть и высушить, самый оптимальный вариант – после мойки обезжирить уайт-спиритом, ацетоном, сольвентом или специальным химическим составом. Также не следует забывать об обработке сварочных швов, они смазываются мастикой.

Замена днища целиком

При значительных повреждениях днище часто меняется целиком, замена в данном случае более выгодна, чем проведение ремонта:

  • покупка одной большой целиковой детали в результате обходится дешевле, чем приобретение всех запчастей по отдельности;
  • объем работы в целом по замене днища получается меньше, чем его ремонт;
  • не нужно тратить время на тщательную зачистку металла от ржавчины, удаление старой шумоизоляции;
  • заменить полностью днище можно достаточно просто, без сварки, высверлив заклепки, а затем установив новый крепеж.

Если вы собираетесь пользоваться сварочным автоматом, при замене пола кузова обязательно необходимо демонтировать топливный бак, несоблюдение техники безопасности может привести к возгоранию или даже взрыву. И хотя работа по замене цельного кузовного элемента с первого взгляда кажется достаточно простой, здесь есть некоторые нюансы – на новом фабричном днище нет шпилек, кронштейна под трос ручника, других крепежных элементов, которые необходимо будет переставлять со старого пола.

Некоторые советы по ремонту днища кузова

  1. Подготавливая железо для заплаток, необходимо учитывать его толщину – слишком тонкий металл будет непрочным, а толстый лист плохо проваривается и тяжелее обрабатывается.
  2. Хотя электросварка в использовании дешевле, лучше сваривать металл с помощью полуавтомата – пользоваться им проще, а сварной шов получается ровнее и аккуратнее.
  3. При вырезке кусков металла и монтаже заплаток устанавливаемая деталь должна точно подходить по размерам.
  4. При замене днища сварочный шов не может быть сплошным, так как он имеет высокую жесткость, а недостаточная эластичность отрицательно влияет на прочность кузова.

И если вы беретесь ремонтировать кузов своими руками, следует запастись терпением, аккуратно, не торопясь, выполнять все необходимые операции, не жалея времени и сил на обработку металла, очищение его от ржавчины. Некачественная подготовка и слабая антикоррозийная обработка приводит к быстрому появлению коррозии, что негативно сказывается на сроке службы кузовных элементов.

Статьи по теме:

Особенности ремонта автомобильных порогов: что важно знать

К сожалению, наши горячо любимые транспортные средства являются очень даже уязвимыми. В частности это касается порогов, которые подвержены различным негативным влияниям природы – холоду и жаре, яркому солнцу и влажности. Рано или поздно на днище могут появляться первые признаки коррозии, которые в большей степени затрагивают пороги транспортного средства.

Коррозия порогов 2110

Но коррозия – это далеко не единственное зло для днища и порогов. Нельзя забывать и о возможных механических и вибрационных воздействиях. В частности, очень часто автолюбители деформируют пороги в процессе использования того же домкрата. Могут быть различные удары о препятствия и во время передвижения. Таким образом, в большинстве случаев просто необходимой является вытяжка, рихтовка или правка деформированных участков. Практика показывает, что если своевременно выполнять работы по восстановлению порогов, то можно быть уверенным, что кузов автомобиля прослужит очень долго.

Виды порогов

Для лучшего понимания стоит выделить два вида порогов – несъемные и съемные. Первый тип приваривается непосредственно к кузову. При этом несъемные пороги в комплексе с дном автомобиля формирует весь его низ. Что касается съемных порогов, то они устанавливаются непосредственно в салоне машины. При этом крепить их необходимо при помощи обычных винтов (непосредственно к кузову). Назначение подобной конструкции понятно – защита от камней, грязи и прочего мусора, который может вылетать из-под колес.

Любой ремонт порогов не обойдется без целого набора необходимых инструментов. В частности, для выполнения работ стоит подготовить опорную плиту, сварку, не лишними будут также инструменты рихтовщика и верстак. Если есть пневмозубило или же болгарка, то это только плюс.

Быстрый ремонт

Если необходимо отремонтировать пороги съемного типа, необходимо учитывать, что делать это гораздо удобнее. В большинстве случаев достаточно просто выкрутить винты и снять порог. Ремонт деформированного изделия необходимо выполнять исключительно на верстаке. При этом для выполнения более точных работ необходимо использовать рихтовочные инструменты. Если повреждения имеют более серьезный характер, к примеру, есть сквозные дыры, то пороги лучше заменить. При этом внутренняя поверхность должна покрываться специальным составом, защищающим от коррозии.

Как ремонтировать приваренные пороги

Такие работы могут иметь различную сложность, в зависимости от вида и тяжести повреждения. Если же пороги не имеют больших складок, то процесс выправления можно производить с наружной стороны. С помощью специального инерционного споттера может производиться последовательная вытяжка. При этом заблаговременно должны быть приварены специальные скобы.

Если повреждение носит достаточно серьезный характер, то снять зону ремонта все-таки придется. В частности, желательно демонтировать сиденья и двери и убрать напольное покрытие.

Если же имеют место серьезные повреждения, то дефектную часть необходимо обязательно удалить. Для реализации такой задачи не обойтись без пневматического зубила или же болгарки.

В ситуациях, когда поврежден не только порог, но и стойки, то ремонтировать данные изделия желательно одновременно.

Выпрямительный блок 21102, 2110. Проверка работы выпрямительного блока Кузов ВАЗ 2110, 21102. Детали кузова

Пороги на ВАЗ 2110: самостоятельная замена

Пороги на ВАЗ 2110 являются элементами конструкции кузова, имеют в своем составе несколько деталей:

  • внутренняя накладка;
  • внешняя накладка;
  • силовой короб.

Если говорить о наиболее уязвимом месте в автомобиле, которое постоянно подвергается коррозии, то нужно вести разговор о порогах. Здесь коррозия чувствует себя превосходно. На ВАЗ 2110 очень часто можно видеть непривлекательные ржавые следы. Они очень быстро превращаются в зияющие отверстия. Иногда следы коррозии скрывает слой краски: гниение порога происходит с внутренней стороны.


Вернуться к оглавлению

Разновидности порогов на ВАЗ

Известно несколько видов порогов ВАЗ 2110. Они бывают:

  • съемными;
  • несъемными.

В большинстве случаев на автомобиль устанавливаются несъемные пороги. Они привариваются к днищу кузова, составляя с ним единое целое. Пороги помогают формировать нижнюю часть каркаса машины. Благодаря рассматриваемым элементам кузов становится жестче.

Чтобы защитить остов авто от различных механических воздействий, от летящей грязи, устанавливают съемные пороги. Они крепятся ко дну кузова обыкновенными саморезами. Современные автомобили оборудуются съемными стальными порогами. В некоторых моделях монтируются пластиковые пороги.

Чтобы провести ремонт съемных порогов, стальных или пластиковых, не надо искать какие-то особые инструменты. Их легко снять, а ремонт можно выполнить в любом подходящем месте. Чтобы была произведена замена порогов ВАЗ 2110, необходимо иметь:

  • электродрель;
  • сверла;
  • шлифовальную машину;
  • зубило;
  • металлический дырокол;
  • струбцины;
  • болгарку;
  • сварочный аппарат;
  • краску грунтовочную;
  • мастику;
  • щетки;
  • отрезные круги;
  • отвертки;
  • гаечные ключи.

Замена порогов ВАЗ-2110 проводится в том случае, когда они не способны выполнять все возложенные на них функции. Однако именно эта часть кузова подвергается коррозии. Борьба с этим явлением обычно не удается. Ржавчина побеждает. Если появились следы коррозии, то никакая антикоррозийная обработка не поможет.


Вернуться к оглавлению

Практические рекомендации по установке

Прежде чем начать ремонт автомобиля, необходимо удалить аккумулятор, так как будут проводиться сварочные работы. В подготовительный этап входит разборка той стороны машины, с которой будет выполняться замена порога. Делаются следующие операции:

  • удаляются коврики;
  • снимается шумоизоляция;
  • отсоединяются ремни безопасности;
  • извлекаются сидения;
  • снимается дверь;
  • откручиваются пластмассовые панели;
  • убираются локеры;
  • отвинчиваются задние колеса;
  • снимается переднее крыло.

Иначе говоря, остается только металл. Должны быть сняты все пластиковые и легковоспламеняющиеся материалы, которые будут создавать помехи работе. Стекла необходимо внутри заклеить бумагой, чтобы пыль, которая будет лететь от болгарки, не оседала на них. Кроме того, желательно закрыть весь салон полиэтиленовой пленкой.

Поверхность зачищается болгаркой. Прогнившая часть днища автомобиля срезается. Удаляется порог, отсекается небольшая часть нижнего соединителя. Если ржавчина затронула и верхний соединитель, его тоже срезают. Завершает подготовительные операции зачистка поверхности металлической щеткой.

Отрегулировав подачу тока на сварочном аппарате, приваривают соединитель и усилитель к новому порогу. Затем все внутренние поверхности промазываются особой антикоррозионной мастикой. Она станет надежной защитой от коррозии. Затем приваривается соединитель. Каждый сварочный шов должен обязательно зачищаться.

Для этого можно использовать болгарку, на которую надет специальный диск. Порог аккуратно приваривается к кузову. Не допускаются непроваренные места. Шов должен быть равномерным и очень крепким. В случае необходимости привариваются заплатки, толщина которых должна соответствовать толщине порога.

После сварки швы вновь зачищаются. Все металлические поверхности покрываются обильным слоем мастики. В салоне сначала укладывается слой мастики, на нее кладется полиэтиленовая пленка, затем — снова мастика. На верхний слой мастики укладывается шумоизоляция, а затем — ковролин. Наружная часть нового порога покрывается несколькими слоями грунтовки. Цвет краски можно подобрать под оттенок автомобиля. Когда выполняются сварочные и покрасочные работы, необходимо иметь:

  • очки;
  • перчатки;
  • респиратор.

При выполнении сварочных работ рядом с автомобилем необходимо всегда иметь несколько ведер воды, чтобы быстро погасить огонь в случае возможного возгорания.


Вернуться к оглавлению

Самостоятельная замена съемных порогов

Пластиковые пороги относятся к съемным деталям. Для того чтобы отремонтировать, их снимают с автомобиля. Они закреплены саморезами, которые легко откручиваются отверткой. Рихтовку порогов делают на верстаке. В случае отсутствия верстака порог нужно положить на ровную и прочную поверхность. Для удаления деформации необходимо применить специальный рихтовочный инструмент.

Обычно при покупке порога стараются подобрать его цвет. Но чаще всего цвет порога отличается от цвета автомобиля. Выход только один: нужна покраска. Такую операцию можно провести своими руками. Прежде чем установить порог, проводят его обезжиривание. После этого на порог наносится краска под цвет кузова. Покраска может проводиться в несколько слоев.

Причем не нужно ждать полного высыхания первого слоя. То есть окрашивание делается «по-мокрому». Обычно выдерживается интервал в 10 минут между нанесением слоев. После наложения последнего слоя порог должен полностью высохнуть. Никаких потрескиваний и вздутий не допускается. При их образовании покрасочные работы нужно повторить.

Чтобы зрительно увеличить боковую часть ВАЗ 2110, устанавливают специальные пластиковые накладки. Внешний вид автомобиля становится более респектабельным. Такие накладки на пороги устанавливаются, когда выполняется тюнинг автомобиля. В основном это аэродинамические обвесы, которые дополняют внешний вид. Сегодня очень популярными стали колесные арки марки «Кураж».

Форма таких изделий соответствует концепции стиля автомобиля. После их установки преображается внешний вид машины. Кроме того, изделие эффективно защищает лакокрасочное покрытие кузовных деталей от летящих из-под покрышек небольших камней. После их установки кузов получит дополнительную защиту, приобретет целостный вид.

Накладки на пороги вместе с колесными арками подчеркивают красивый дизайн автомобиля, дополняют проведенный тюнинг внешними деталями. Крепление осуществляется саморезами, которые промазываются герметиком. Изготавливаются пластиковые детали из специальной высокопрочной пластмассы.

Любой порог придает автомобилю великолепные аэродинамические свойства. Он гармонично сочетается с внешним видом автомобиля и выполняет защитные функции.

Ремонт порогов автомобиля без сварки

В машине все внешние детали кузова со временем получают определенные повреждения. Чем солиднее возраст авто, а также больше пробег, тем выше шансы владельцу заниматься восстановлением данного кузовного элемента. Если у Нивы или ВАЗ 2110 со временем проржавели, а также сгнили пороги, что делать с ними, как починить становится очень актуальным вопросом.

Но не всегда автолюбители спешат в СТО. Владельцы машин обладающие необходимыми знаниями, навыками, а также специальным инструментом вполне могут сделать ремонт своими руками.

Виды повреждений и методы реставрации

Сегодня российский рынок машин предлагает модели с различными видами порогов. Они могут быть как приваренные, так и съемные. Первый тип, представляющий собой одно целое с кузовом, отремонтировать можно только с применением сварки. Второй вид легко восстановить самостоятельно. Нужно лишь снять двери и крылья, открутить саморезы и заменить деталь.

Способ выполнения ремонта порогов автомобиля без сварки своими руками выбирают в зависимости от типа повреждений. Чаще всего они встречаются следующие:

  • механические – образующиеся от ударов камней, гравия или иного воздействия;
  • коррозионные – возникающие в процессе окисления металлических деталей.

Исправление небольших вмятин выполняется после демонтажа порога с помощью киянки. В случае отслоения лакокрасочного покрытия, такой участок окрашивается. При работе с металлическими деталями поврежденные места правильно обрабатываются и покрываются противокоррозионным составом. Потом их обязательно нужно покрасить после ремонта.

Если съемные пороги проржавели до сквозных дыр, лучше их заменить на новые. На многих машинах, как УАЗ Патриот или ВАЗ 2114, это выйдет и проще, и дешевле.

Приваренный порог это часть конструкции и его ремонт проводиться по другому сценарию. Незначительные повреждения выравниваются с наружной стороны. Небольшие вмятины можно выпрямить после просверливания отверстия и с помощью специальных инструментов. Как вытянуть порог автомобиля своими руками таким способом можно посмотреть в интернете на специальных сайтах, где дается пошаговая инструкция.

При обильном поражении ржавчиной сначала производится полная зачистка поверхности, после этого она обезжиривается и окрашивается. Сложность ремонта не съемных порогов требует, чтобы его выполнял специалист. Поэтому столкнувшись с такой проблемой нужно воспользоваться услугами мастеров из Веб Автосервиса.

Цены на восстановление порогов вашего автомобиля (легковые):

Мы находимся по адресу: г. Москва, ул. Академика Опарина, 5

Время работы автосервиса: eжедневно ПН-ВС с 8:00 до 21:00.

Телефоны для связи: 8 (800) 201-84-24

Ремонт днища ВАЗ 2110, ремонт порогов, причины коррозии днища ВАЗ 2110. Как самостоятельно отремонтировать днище ВАЗ на 2110. Ремонт днища ВАЗ 2110 своими руками.


Женщина за рулём Газель Некст 2018
[S.A.A.G] Как гниет ВАЗ 2112 (Замена задних арок и ремонт лонжерона)
Почему так случилось? Ремонт ВАЗ 2112.

Оценить текущее состояние транспортного средства во многом можно благодаря анализу кузова. Разнообразные расходники подлежат замене, подвеску можно перебрать посредством замены изношенных и неисправных деталей, у силового агрегата тоже ремонтируется либо заменяется навесное оснащение, в крайнем случае выполняется капитальный ремонт либо же полная его замена. Ну а что касается восстановления полностью поржавевшего кузова, то это бессмысленно и дорого. Никто не станет дорабатывать, тюнинговать, вкладывать большие средства в автомобиль, кузов которого доживает последние годы. В таком случае стоимость транспортного средства значительно падает, даже если двигатель окажется в отличном состоянии. Поэтому очень важно следить за кузовом и систематически проводить профилактические и ремонтные кузовные работы, которые направлены на борьбу со ржавчиной. Об этом далее в статье. 

Ржавчина днища ВАЗ 2110, причины появления ржавчины

К основным причинам возникновения коррозии днища можно отнести:

Возраст .
Некачественный ремонт .
Аварии .
Влажность в гараже .
Погодные условия (снег, дождь).
Влага в салоне .
Езда по гравию .

Как бороться с ржавчиной на кузове автомобиля, меры профилактики

Возраст.  Уже спустя 5-7 лет на днище и кузове могут возникнуть следы коррозии. К сожалению, не существует средств против возраста.
Некачественный ремонт.  Не стоит экономить на ремонте кузова, так как неквалифицированный специалист толком ничего не сделает, он только отнимет ваши деньги и время. Выбирайте проверенные СТО и опытных мастеров.
Аварии.  Избегайте аварий. Это единственная рекомендация в данном случае.
Влажность в гараже.  Защищайте помещение от влаги, в зимнее время регулярно включайте в гараже тепловой вентилятор, отопитель.


Погодные условия.  Старайтесь смывать и сбивать снег, который налип под днищем. Особенно, если вам часто приходится ездить по дорогам, которые посыпаны реагентами или солью для растапливания льда и снега.
Влага в салоне.  Влага попадает в салон через мокрую обувь. Из-за этого днище гниет изнутри. В зимнее время обязательно стелите резиновые коврики, у которых есть борт, а также следите, чтобы вода не попадала в салон при дожде или мойке.
Езда по гравию.  Подобных дорог следует избегать, так как мелкие камни способны разрушать антигравийное покрытие, после чего на кузове появляется коррозия.


Поржавевшие пороги

Как увеличить срок службы днища автомобиля

Для увеличения срока службы вашего автомобиля необходимо систематически выполнять антикоррозийную обработку. При этом важно уделять особое внимание скрытым полостям порогов и лонжеронов.

Как найти ржавчину на днище, на что обращать внимание при обследовании днища автомобиля

Не сложно определить наличие коррозии на днище. Хотя если вы купили транспортное средство с рук, данные проблемы могут хорошо замаскировать.

Осмотрите кузов снизу. Ржавчина может скрываться за слоем шпаклевки или антигравийного покрытия. Воспользуйтесь шилом или молотком, нанеся несильные удары по данным местам. Если ржавчина есть, вы это заметите.
Проверьте состояние кузова в салоне возле ног водителя и переднего пассажира, а также вдоль порогов. На ВАЗ 2110 именно данные места считаются самыми слабыми.
Если днище прогнило, это можно заметить по тому, как прогибается пол под ногами в условиях нагрузок.
Если водительское кресло невозможно сместить или его срывает, это тоже может говорить о прогнившем кузове.
Одной из самых неприятных ситуаций являются прогнившие упорные площадки, которые предназначены для подъема автомобиля на домкрате.

Выбор рабочего места

Все роботы проводятся в гараже или другом оборудованном помещении. Поставьте транспортное средство на подставки.

Техника безопасности при работе

Добейтесь такого расположения автомобиля, чтобы под ним было удобно и безопасно работать. Обязательно отключите аккумулятор.

Инструменты, приспособления, расходные материалы

При выполнении ремонтных работ вам потребуются такие инструменты:

Шлифовальная угловая машинка . Понадобится для подгонки заплаток и элементов, очищения поверхностей и швов, а также при потребности убрать с пола ржавчину.
Сварочный аппарат.  При ремонте днища автомобиля желательно использовать полуавтомат с углекислотой и проволокой. Это надежнее, эффективнее и лучше, чем электроды и газ.


Подставки под транспортное средство.  Здесь можно использовать разные предметы.
Остальной набор инструментов и материалов стандартный и включает в себя следующие элементы:  краска, листы шумоизоляции, грунтовка, наждачная бумага, проволока для сварки, мастика для швов, антикоррозийный раствор. 

Подготовительные работы (подробно о демонтаже)


Подъем автомобиля

В первую очередь демонтируем двери. В этом случае специалисты рекомендуют предусмотреть распорки для дверных проемов, чтобы сохранить геометрию кузова и его жесткость.
Так как ремонтировать днище необходимо не только под машиной, а и изнутри, придется полностью разбирать салон. Данная задача сложная и отнимет много времени. Вам придется демонтировать: ковровые покрытия, кресла, воздуховоды, облицовку тоннеля пола, шумоизоляционный слой.
Аккуратно собираем всю проводку и объединяем в пучки, во избежание проблем со сборкой. Важно собрать все крепежи, распределить их по коробочкам и подписать.
Если планируется сварка панели на пол или полная замена днища, тогда придется снять торпеду и бороду для создания открытого доступа к моторному щиту.

Элементы кузова ВАЗ 2110, которые чаще всего меняют полностью

К элементам кузова ВАЗ 2110, которые зачастую меняют полностью, относят:

Опорные площадки.
Напольные панели.
Надставок лонжерона.
Надставок порога.
Соединители.
Поперечина.

Сварочные работы при ремонте днища

Для замены старой детали нужно высверлить ее в сварных точках либо просто срезать с помощью болгарки.
Не стоит забывать, что под днищем находятся трубопроводы топливной и тормозной системы. Их крайне сложно демонтировать, поэтому проще срезать, а при сборке установить новые компоненты трубопроводов.
Всегда заводите днище внизу, а затем прихватите.


Если половые панели находятся в критическом состоянии, днище необходимо полностью заменить. Однако в данном случае обязательно нужно демонтировать выхлопную систему.
Не стоит делать основную сварку при помощи сплошного шва. Важно соблюдать шаг примерно четыре-пять сантиметров.

Замена порогов, советы по сварке

При потребности поменять пороги, необходимо их демонтировать и установить новые поочередно. При этом важно контролировать геометрию.
В случае, если замена порогов и пола выполняется одновременно, первыми меняются пороги, а затем напольные панели.
Без помощника вам не обойтись.
Тщательно проводите разметку компонентов для сварки. Старые элементы должны точно соответствовать вырезаемым новым.

Защита обновленного днища от коррозии (последовательность работы)

Удалив окалину, зачищаем металл до блеска.
Смазываем поверхности при помощи шовной мастики.
Обрабатываем грунтовкой металлические элементы.
Наносим слой краски.
Снаружи обрабатываем днище с помощью антигравийного состава и мастики.
Тщательно замеряем и вырезаем ножницами листовую шумоизоляцию. Ее необходимо нагреть промышленным феном и уложить на днище (если это битумная шумка).


Обновленный кузов

Советы профи: обратная сборка, как запомнить и восстановить все без проблем

Если правильно разобрать салон и демонтировать элементы днища, не должно возникнуть проблем с их сборкой. Желательно прописать каждый этап и записать на видео, а также подписать каждую коробочку с компонентами крепления.

Ремонт днища ВАЗ 2110, ремонт порогов, причины низа днища ВАЗ 2110. Как самостоятельно отремонтировать днище ВАЗ на 2110. Ремонт днища ВАЗ 2110 своими руками.

Текущее состояние автомобиля можно оценить разными способами благодаря анализу кузова. Замене подлежат самые разные расходные материалы, подвеску можно разобрать, заменив изношенные и неисправные детали, также ремонтируется силовой агрегат либо заменяется навесное оборудование, в крайнем случае проводится капитальный ремонт или его полная замена.Ну а восстановление полностью сломанного кузова бессмысленно и дорого. Никто не будет дорабатывать, тюнинговать, вкладывать большие деньги в машину, кузов которой живет в последнее время. В этом случае стоимость автомобиля значительно снижается, даже если двигатель в отличном состоянии. Поэтому очень важно следить за кузовом и систематически проводить профилактические и ремонтные работы, направленные на борьбу с ржавчиной. Об этом далее в статье.

Ржавчина днища ВАЗ 2110, причины появления ржавчины

К основным причинам возникновения коррозии днища можно отнести:

  • Возраст .
  • Некачественный ремонт .
  • Несчастный случай .
  • Влажность в гараже .
  • Погода (снег, дождь).
  • Влага в салоне .
  • Езда по гравию. .

Как бороться с ржавчиной на кузове автомобиля, меры профилактики

  • Возраст. Уже через 5-7 лет на днище и кузове могут появиться следы коррозии.К сожалению, нет средств против возраста.
  • Некачественный ремонт. Не экономьте на ремонте кузова, так как неквалифицированный специалист толком ничего не сделает, только ваши деньги и время. Выбирайте проверенную СТО и опытных мастеров.
  • Несчастный случай. Избегайте несчастных случаев. Это единственная рекомендация в данном случае.
  • Влажность в гараже. Защищайте помещение от влаги, зимой регулярно включайте в гараже тепловентилятор, обогреватель.
  • Погода. Попробуйте помыть и постучать по снегу, который налип под днищем. Особенно, если вам часто приходится ездить по дорогам, которые поливают реагентами или солью для растапливания льда и снега.
  • Влага в салоне. Влага попадает в салон через мокрую обувь. Из-за этого изнутри гниет дно. Зимой обязательно перекручивайте резиновые коврики, на которых есть доска, и следите, чтобы вода не попала в салон во время дождя или стирки.
  • Езда по гравию. Таких дорог следует избегать, так как мелкие камни способны разрушить антирастущее покрытие, после чего на кузове появляется коррозия.
Пороги штрафных

Как увеличить ресурс днища автомобиля

Для увеличения срока службы вашего автомобиля необходимо систематически проводить антикоррозийную обработку. При этом важно обратить особое внимание на скрытые полости порогов и лонжеронов.

Как найти ржавчину на днище, обратить внимание на осмотр днища автомобиля

Определить наличие коррозии на днище несложно. Хотя, если вы купили автомобиль с рук, эти проблемы можно хорошо замаскировать.

  1. Осмотрите кузов снизу. Ржавчина может скрываться за слоем шпатлевки или антизагарного покрытия. Воспользуйтесь отбором или молотком, применив разблокировки из этих мест. Если есть ржавчина, вы ее заметите.
  2. Проверить состояние кузова в салоне у ног водителя и переднего пассажира, а также по порогам. На ВАЗ 2110 именно эти места считаются самыми слабыми.
  3. Если дно сгнило, это можно заметить по тому, как пол гнулся под ногами в условиях нагрузок.
  4. Если водительское сиденье невозможно сдвинуть или сломается, то это тоже может говорить о гнилом кузове.
  5. Одна из самых неприятных ситуаций — гнилые детские площадки, которые предназначены для подъема машины на домкрат.

Выбор рабочего места

Все роботы содержатся в гараже или другом оборудованном помещении. Поставьте автомобиль на подставку.

Безопасность на работе

Сделайте так, чтобы автомобиль находился под ним удобно и безопасно. Обязательно отсоедините аккумулятор.

Инструменты, приспособления, расходные материалы

При выполнении ремонтных работ вам потребуются такие инструменты:

  • Станок угловой шлифовальный . Понадобится подогнать заплатки и элементы, очистить поверхности и швы, а также нужно удалить ржавчину с пола.
  • Сварочный аппарат. При ремонте днища автомобиля желательно использовать полуавтомат с углекислотой и проволокой. Он надежнее, эффективнее и лучше электродов и газа.
  • Стенды для автомобиля. Здесь можно использовать разные предметы.
  • Остальные инструменты и материалы стандартные и включают следующие элементы: краска , листы шумоизоляции, грунтовка, наждачная бумага, сварочная проволока, мастика для швов, антикоррозийный раствор.

Подготовительные работы (деталь о демонтаже)

Подъемная машина
  1. В первую очередь демонтируем двери. В этом случае специалисты рекомендуют предусмотреть проставки для дверных проемов, чтобы сохранить геометрию кузова и его жесткость.
  2. Так как ремонт днища необходим не только под машиной, но и изнутри, придется полностью разбирать салон. Эта задача сложная и требует много времени. Придется демонтировать: ковролин, кресла, воздуховоды, облицовку туннелей пола, шумоизоляционный слой.
  3. Аккуратно соберите всю проводку и объедините в жгуты, чтобы не было проблем со сборкой. Важно собрать все застежки, разложить по коробкам и расписаться.
  4. Если вы планируете приварить панель к полу или полную замену днища, то вам придется снять торпеду и бороду для создания открытого доступа к моторному щиту.

Кузовные элементы ВАЗ 2110, которые чаще всего меняют полностью

К элементам кузова ВАЗ 2110, которые часто полностью меняются, относятся:

  • Сайты поддержки.
  • Наружные панели.
  • Отказ от лонжерона.
  • Порог.
  • Разъемы.
  • Крест.

Сварочные работы при ремонте днища

  1. Для замены старой детали необходимо просверлить ее в местах сварки или просто отрезать с помощью болгарки.
  2. Не забываем, что под днищем проходят трубопроводы топливной и тормозной системы. Их крайне сложно демонтировать, поэтому их легче разрезать, а при сборке установить новые составные части трубопроводов.
  3. Всегда начинайте снизу снизу, а затем хватайтесь за него.
  4. Если панели пола в критическом состоянии, необходимо полностью заменить днище. Однако в этом случае необходимо произвести демонтаж выхлопной системы.
  5. Запрещается выполнять простую сварку сплошным швом. Важно соблюдать шаг примерно в четыре-пять сантиметров.

Замена порогов, сварочных наконечников

  1. Если нужно поменять пороги, нужно поочередно их демонтировать и устанавливать новые.Важно контролировать геометрию.
  2. Если замена порогов и пола производится одновременно, то меняют сначала пороги, а затем панели пола.
  3. Без помощника вам не обойтись.
  4. Тщательно проведите разметку компонентов под сварку. Старые элементы должны точно соответствовать новым.

Защита обновленных днищ от коррозии (последовательность работ)

  1. Удаление накипи, зачищаем металл до блеска.
  2. Смажьте поверхность шовной мастикой.
  3. Переходим к грунтовке металлических элементов.
  4. Нанести слой краски.
  5. Снаружи обрабатываем дно антизагарным составом и мастикой.
  6. Тщательно отмерьте и срежьте ножницами лист изоляции. Ее необходимо прогреть промышленным феном и положить на дно (если это битумная шумка).
Обновленный кузов

Советы Плюсы: обратная сборка, как все запомнить и восстановить без проблем

Если правильно разобрать салон и демонтировать элементы днища, проблем с их сборкой возникнуть не должно.Каждый этап желательно регистрировать и записывать на видео, а также подписывать каждую коробку с элементами крепления.

Коммунальные работы в полосе отвода — транспорт

Временное закрытие счетчика разрешений

Для защиты здоровья и безопасности наших сотрудников и клиентов, а также для смягчения последствий COVID-19 мы закрыли открытые стойки обслуживания клиентов в понедельник, 16 марта 2020 г. O У нас счетчики закрыты до дальнейшего уведомления. Сюда входят счетчики разрешений на использование улиц и на движение и парковку в Сиэтлской городской башне на 23 и 37 этажах. Мы все еще обрабатываем заявки на получение разрешения.

Вы можете подавать заявки на все типы разрешений онлайн через портал Seattle Services.

Наши сотрудники будут готовы помочь вам в оформлении заявок и оформлении разрешений по телефону или электронной почте. Узнайте больше о том, как сейчас осуществляется парковка на улице.

Запросы о статусе

7 ноября 2020 года мы перейдем на нашу новую разрешительную платформу Accela. Чтобы обеспечить плавный переход, наши команды будут принимать участие в обширных тренингах по новой системе в течение оставшейся части сентября и октября.

В это время мы по-прежнему будем обрабатывать разрешения, но будем работать с ограниченной производительностью. Поскольку наша основная задача — своевременная обработка разрешений, мы не сможем отвечать на запросы о статусе в течение этого времени, если заявка находится в рамках опубликованных сроков выдачи разрешений, опубликованных на наших веб-страницах разрешений.Благодарим вас за терпение во время этого перехода.

Как оценить сроки выдачи разрешений на использование улиц

Дополнительную информацию по следующим темам можно найти в справочной статье «Общие сведения о процессе получения разрешения на использование улиц, состоянии записи, целевых датах и ​​сроках разрешения».

  1. Каковы этапы процесса получения разрешения на использование улиц?
  2. Что происходит на каждом этапе разрешения и как он присваивается?
  3. Как мне проверить и понять статус записи SDOT Street Use?
  4. Что означает «Дата назначения» и как она определяется?
  5. Сколько времени занимает весь процесс получения разрешения?

По состоянию на 10 мая 2021 г. время проверки составляет:

Для всех типов разрешений

  • Срок подачи заявок: 3 рабочих дня

Сроки выдачи разрешений ROWM (включая время подачи заявки)

  • Первоначальная полная проверка: 8-9 недель
  • Единичный просмотр: 3-4 недели
  • Добавочный номер: 5-10 рабочих дней

Сроки получения разрешения на благоустройство улицы (включая время подачи заявки)

  • Первоначальный полный обзор: 7-9 недель
  • Обзор исправлений: ок.6 недель

Сроки выдачи основных разрешений на коммунальные услуги (включая время подачи заявки)

  • Первоначальный полный обзор: 8-10 недель
  • Проверка исправлений: 6-8 недель

Сроки выдачи разрешений PSM (включая время подачи заявки)

  • Первоначальный полный обзор: 10-12 недель
  • Простой просмотр: 5-8 недель

Это средние сроки. Из-за увеличения количества заявок на получение разрешений в сочетании с сокращением мощностей наши сроки превышают обычные.Мы усердно работаем над сокращением этих сроков в преддверии перехода на Accela в ноябре.

ПРИМЕЧАНИЕ : Если требуется совещание по Руководству по проектированию управления полосами отвода или необходимы циклы исправлений, к указанным выше срокам будет добавлено дополнительное время.


Мы объединились с Rooted in Rights, чтобы создать видео, чтобы рассказать подрядчикам и другим людям, работающим в полосе отвода, о важности обеспечения безопасного пространства для людей при перемещении по строительным площадкам.Эти советы полезны не только для инвалидов-колясочников, они делают сайты безопаснее для всех!

Вы можете узнать больше о том, как настроить безопасный доступ через строительную площадку, в разделе «Планирование, документирование и реализация пешеходной мобильности в рабочих зонах и вокруг них» (CAM 2110).

Шаг 1. Определите, какое разрешение на коммунальное предприятие подходит для вашей работы

Доступны два типа разрешений на коммунальные услуги: второстепенное разрешение на коммунальные услуги (SUUTIL) и крупное разрешение на коммунальные услуги (SUUMP).Эти два разрешения различаются по сложности проекта и по тому, как работа повлияет на полосу отвода.

Разрешения на мелкие коммунальные услуги (SUUTIL) охватывают несложные работы в небольших географических районах. Работа, разрешенная на основании разрешения на малые коммунальные услуги, включает:

  • Географические работы ограничены радиусом в один блок
  • Краткосрочные одиночные услуги по установке, техническому обслуживанию или ремонту инженерных сетей (газ, вода, электроэнергия, телекоммуникации и т. Д.)
  • Разведочные / разведочные / мониторинговые скважины и т. Д.
  • Установка, замена, снятие опор и крепление опор
  • Боковая канализация / дренажные работы одобрены Департаментом строительства и инспекции Сиэтла (SDCI)
    • Примечание: Теперь вы можете подать заявление на получение разрешения SDOT Side Sewer в любое время или запросить его при подаче заявления на получение разрешения SDCI Side Sewer. Инструкции о том, как подать заявку на разрешение SDOT Side Sewer можно найти здесь.

Основные разрешения на коммунальные услуги (SUUMP) охватывают более сложные проекты или работы, которые охватывают географическую зону с радиусом более одного квартала.Если ваш проект соответствует одному или нескольким из следующих пороговых значений, вам необходимо будет подать заявление на получение разрешения на крупное коммунальное хозяйство:

  • Географические работы, превышающие радиус одного блока
  • Любой проект, связанный со сложными техническими проблемами * (например, глубокие раскопки), которые могут повлиять на существующие городские активы и / или инфраструктуру
  • Прокладка магистральных газопроводов диаметром более 2 дюймов
  • Прокладка инженерной линии длиной более 100 погонных футов на неартериальной или артериальной улице, включая переулки
    • Исключение: Прокладка инженерной линии протяженностью до 300 линейных футов на улице или переулке, не являющейся магистралью, в одной семье или в малоэтажной зоне может быть разрешена в соответствии с разрешением на коммунальные предприятия.
  • Удаление подземного резервуара
  • Экологические реабилитационные работы или удаление загрязненных почв
  • Работа, которая вызывает установку пандуса ADA из-за инженерных работ (например, снятие / установка опор на перекрестках)
  • Метод установки направленного или горизонтального растачивания

* Нам может потребоваться UMP сверх пороговых значений, указанных выше, учитывая сложность работы, включая близость к существующей инфраструктуре или активам.

Основные объекты общественного пользования (например, водопровод, ливень, канализация и т. Д.) Теперь разрешены в соответствии с разрешением на благоустройство улиц (SIP). Посетите наш веб-сайт разрешений на благоустройство улиц для получения дополнительной информации о процессе SIP.

Вернуться к началу страницы


Шаг 2: Подготовьте документы, необходимые для подачи

Для подачи заявки потребуются следующие документы:

Незначительные разрешения на коммунальные услуги (SUUTIL)
Тип документа Описание документа
План защиты от столкновений с полосой отвода (ROWIP) Затворы для полосы отвода с деталями по CAM 2116
План участка Информация о местонахождении инженерных сетей согласно CAM 2116
Доверенность Требуется, если заявитель или контактное лицо FRP отличается от контактного лица Владельца.


Если заявка отправлена ​​по ошибке, вы можете отозвать заявку, нажав кнопку «Внести изменения» в записи и выбрав «Отменить» и нажав кнопку «Продолжить заявку».Инструкции по снятию заявки можно найти здесь.

Вы не можете вносить какие-либо изменения в заявку после ее отправки. Если в процессе проверки необходимо внести изменения в заявку и / или документ, отправьте эти запросы на изменение по электронной почте назначенному рецензенту или по адресу [email protected], если запись не назначена.

Вы не можете вносить какие-либо изменения в заявку после ее подачи. Если в процессе рассмотрения заявки и / или документа необходимо внести изменения, отправьте эти запросы на изменение по электронной почте на адрес SDOTPermit @ seattle.губ.

Вернуться к началу страницы


Шаг 3. Определите, могут ли потребоваться другие документы

Документы, которые не требуются для подачи заявки на разрешение на коммунальные услуги, могут потребоваться позже в процессе получения разрешения. Ниже приведен список документов, которые могут потребоваться в зависимости от объема проекта, местоположения и типа разрешения.

Для разрешений на коммунальные услуги следуйте приведенным ниже инструкциям. Требования к документам устанавливаются в соответствии с одним из указанных ниже этапов получения разрешения.

Тип документа Описание документа Шаг разрешения, когда требуется документ
План защиты от столкновений с полосой отчуждения (ROWIP) Затворы для полосы отвода с деталями по CAM 2116 Только SUUMP — Скрининг после первого цикла проверки
Диспетчер расписания фаз График строительства по фасаду Только SUUMP — Скрининг после первого цикла проверки — можно загрузить в приложении
План управления движением (TCP) Временный план управления движением согласно CAM 2111 и Руководство города Сиэтла по управлению движением для работы на улице Либо в Приложение , если категория улиц вручную установлена ​​на Артериальная, либо в Проверка , когда проверяющий проверяет, что работа ведется на магистрали или любой улице в Хабе, и это влияет на подвижность пешеходов, велосипедов и / или транспортных средств

Подтверждение временного отсутствия парковки

(Разрешение на платную парковку)

Если проект влияет на платную парковку, какое-то доказательство того, что разрешение на парковку было предоставлено Обзор оценки
Прочие документы В зависимости от местоположения и воздействия проекта; CoA исторического района, отказ от праздничного моратория согласно CAM 2107, мораторий на тротуары и т. Д. Обзор оценки
Исправление Ответ Street Используйте лист комментариев с ответами Проверка — невозможно отправить Исправления Отправлены, если это необходимо

Вернуться к началу страницы

Шаг 4. Подайте заявку на разрешение

Заявки на коммунальные услуги должны подаваться через портал обслуживания в Сиэтле. После того, как вы вошли в систему, вы можете подать заявку на получение разрешения на коммунальные услуги, следуя инструкциям здесь.

Вернуться к началу страницы


Шаг 5. Проверьте статус вашего разрешения на рассмотрении

Текущие сроки можно найти на нашем веб-сайте, посвященном разрешению использования улиц и обновлениям. Дополнительную информацию по следующим темам можно найти в справочной статье «Общие сведения о процессе получения разрешения на использование улиц, статусе записи, целевых датах и ​​сроках разрешения».

    • Каковы этапы процесса получения разрешения на использование улиц?
    • Что происходит на каждом этапе разрешения и как он присваивается?
    • Как мне проверить и понять статус записи SDOT Street Use?
    • Что означает «Дата назначения» и как она определяется?
    • Сколько времени занимает весь процесс получения разрешения?

К началу страницы


Шаг 6. Ответьте на исправления при проверке

Когда требуется пересмотренный и / или дополнительный документ, прежде чем мы сможем продолжить или завершить процесс проверки, будет отправлено автоматическое уведомление по электронной почте, в котором будет указано, что статус записи был изменен на «Ожидает исправлений».’

Необходимые документы будут указаны в качестве условия разрешения. Для получения подробной информации о каждом условии нажмите кнопку Просмотреть условие в записи.

Если требуется условие «Ответ по исправлению», вам нужно будет загрузить лист комментариев об использовании улиц с вашими ответами.

Чтобы загрузить лист комментариев об использовании улиц и размеченные документы (если применимо), перейдите на вкладку Attachments своей записи и щелкните синюю гиперссылку для каждого документа, который вы хотите загрузить.

После того, как отредактированные и / или дополнительные документы будут готовы к отправке, нажмите кнопку Загрузить на вкладке Вложения .

Инструкции по реагированию на исправления можно найти здесь.

Вернуться к началу страницы


Шаг 7. Получите разрешение

Как только ваш отзыв будет одобрен, вы получите электронное письмо о том, что ваше разрешение было выдано. Если есть сборы, в электронном письме будет указано, что ваше разрешение готово к выдаче после оплаты.Вы можете узнать больше о том, как оплатить разрешение в Accela, здесь.

Войдите в Seattle Services Portaland и откройте запись о разрешении. Вы сможете распечатать свое разрешение и все утвержденные документы, находящиеся на вкладке «Вложения» в записи.

Инструкции о том, как найти разрешение и другие приложенные к записи документы, можно найти здесь.

Информацию о разрешительных сборах и способах их расчета можно найти на нашем веб-сайте «Как рассчитывать и оплачивать сборы за разрешения».

Вернуться к началу страницы


Шаг 8: Требования к уведомлению, началу работы и временному запрету на парковку

Перед тем, как начать свой проект, вам необходимо предоставить следующее уведомление:

  1. Общественное уведомление перед запуском вашего проекта согласно CAM 2117
  1. Уведомление о начале задания, позволяющее инспектору использовать улицу, когда вы начнете свой проект в соответствии с инструкциями, приведенными здесь.После прохождения первоначальной проверки может потребоваться запланировать дополнительные проверки. Для получения дополнительной информации о типах проверок и о том, как их планировать, посетите наш веб-сайт проверок.
  1. Уведомление и разрешения о неоплачиваемой или платной парковке на нашем веб-сайте Временных разрешений на парковку.

Вернуться к началу страницы


Шаг 9: Подайте заявку на внесение поправок для изменения / продления вашего разрешения

После выдачи разрешения необходимо внести изменения в заявку, объем работ и / или дату, подав заявку на внесение поправок через портал обслуживания в Сиэтле.

Изменения имеют другие (более короткие) этапы процесса, чем первоначальная заявка. Для внесения поправки документы не требуются, но могут быть загружены по желанию.

Когда выпускается Поправка, она обновляет информацию о своей родительской (начальной) разрешительной записи.

После выдачи разрешения будут доступны следующие типы поправок:

Поправка об изменении даты — используется для запроса изменения даты начала использования в выданном разрешении до начала использования.

  • Использование не может быть добавлено или продлено, а продолжительность не может быть изменена
  • Невозможно запросить изменение объема работ и / или заявки
  • В областях Hub вам нужно будет согласовать даты, выходящие за рамки первоначальных дат выпуска и периодов продления, прежде чем продолжить работу (электронная почта [email protected])
  • Инструкции по подаче заявки на изменение даты можно найти здесь.

Поправка о продлении — используется для запроса продления срока действия в пределах текущей 6-месячной даты истечения срока или для продления существующего (-ых) использования (-ей) после 6-месячной даты истечения срока действия

  • Использование не может быть добавлено
  • Невозможно запросить изменение объема работ и / или заявки
  • В областях Hub вам нужно будет согласовать даты, выходящие за рамки первоначальных дат выпуска и периодов продления, прежде чем продолжить работу (электронное письмо SDOTConstructionHub @ seattle.gov)
  • Инструкции по подаче заявки на поправку о продлении можно найти здесь.

Revision Amendment — используется для запроса изменений информации о приложении (контакт, адрес и / или соответствующая информация), изменения объема работ (изменение рабочей зоны, добавление или удаление использования) и / или расширения существующего использования (я)

  • Заявку и объем работ можно запросить в описании поправки
  • Использование может быть добавлено и расширено
  • Изменения объема работ потребуют загрузки исправленных документов (например,грамм. ROWIP, план участка, TCP, график проекта и т. Д.), И необходимо будет выполнить полную проверку
  • Инструкции о том, как подать заявку на внесение поправок, можно найти здесь.

Уведомление об аварийных работах и ​​требования к разрешениям

Аварийные работы — это когда общественное здоровье, безопасность и / или благополучие находятся под угрозой. При аварийных работах следует немедленно принимать меры для обеспечения здоровья и безопасности населения. С инспектором SDOT Street Use следует связаться, как только группа реагирования начнет мобилизацию.Заявление о разрешении на выполнение аварийных работ необходимо подать в течение 24-48 часов после начала ответных работ.

Чтобы указать, что работа связана с реагированием на аварийную ситуацию, объясните аварийные работы в проекте и описании местоположения и выберите «Аварийный» приоритет разрешения в процессе подачи заявки. Чтобы подать заявку на разрешение, необходимо загрузить простой план воздействия на полосу отвода (ROWIP), который как минимум показывает место работы.

Если продолжительность аварийных работ превышает 5 календарных дней, необходимо подать заявку на внесение поправок на портал обслуживания в Сиэтле и загрузить необходимые документы в соответствии с этапом Step 3 выше.

Если после аварийных работ требуются дополнительные работы, необходимо применить поправку к редакции в соответствии с Шаг 9 выше.

Истечение срока действия разрешения в сравнении с истечением срока использования (шестимесячный срок действия)

Разрешения на коммунальные услуги теперь имеют 6-месячный срок действия, что позволяет завершить этапы строительства в течение 6-месячного периода.

Продление использования в течение 6-месячного периода истечения срока требуется только в том случае, если продолжительность работы превышает первоначально выданную продолжительность или если работа продлевается после истечения срока действия разрешения.

Дата истечения 6-месячного разрешения будет заполнена, как описано ниже:

Первоначальная выдача:

  • Срок действия = Дата начала использования + Продолжительность
  • Срок действия разрешения = последняя дата истечения срока действия + 6 месяцев

Поправка после Последней даты истечения срока годности:

  • Срок действия = Дата начала использования + Продолжительность
  • Срок действия разрешения = Последняя дата истечения срока действия + 6 месяцев

Выдача поправок до Последняя дата истечения срока годности:

  • Срок действия = Дата начала использования + Продолжительность
  • Срок действия разрешения = Дата выдачи + 6 месяцев

Требования к согласованию проекта и строительства

Все агентства, выполняющие работы в полосе отвода, запланированные как минимум за шесть месяцев, должны по закону (SMC 15.32.050) вводят информацию о своем проекте в точечные карты (если не исключены критерии, определенные в SMC 15.32.050). Когда проект вводится в dotMaps, создается номер плана улучшения улиц и инженерных сетей (SUIP), который необходимо включить в приложения SUUTIL и SUUMP. Более подробную информацию можно найти на веб-странице Координационного бюро проектов и строительства.

Если ваша работа находится в зоне хаба: После первоначальной выдачи или внесения поправок и до истечения срока действия разрешения любые изменения разрешенных дат использования должны быть согласованы с координатором хаба по электронной почте SDOTConstructionHub @ seattle.губ.

Если ваша работа находится за пределами зоны хаба: После первоначальной выдачи или внесения поправок и до истечения срока действия разрешения любые изменения разрешенных дат использования должны быть проверены в сравнении с другими запланированными работами в точечных картах до начала работы.

Ресурсы:

Памятки по оказанию помощи клиентам (CAM)
Сиэтл Руководство по улучшениям ROW (ROWIM)
Стандартные планы и спецификации Сиэтла
Рекомендации по проектированию SPU для общественных водостоков
Правила открытия и восстановления полосы отвода ROWORR
Street Use website

Вернуться к началу страницы

Seite nicht gefunden — Rinaldi-Racing

Seite nicht gefunden — Rinaldi-Racing

Извините, но запрошенный ресурс не найден на этом сайте.Повторите попытку или обратитесь за помощью к администратору.

Wir nutzen Cookies на веб-сайте. Einige von ihnen sind essenziell, während andere uns helfen, diese Website und Ihre Erfahrung zu verbessern.

Alle akzeptieren

Speichern

Печенье Nur essenzielle akzeptieren

Individualuelle Datenschutzeinstellungen

Cookie-Подробности Datenschutzerklärung Impressum

Datenschutzeinstellungen

Hier finden Sie eine Übersicht über alle verwendeten Cookies.Sie können Ihre Einwilligung zu ganzen Kategorien geben oder sich weitere Informationen anzeigen lassen und so nur bestimmte Cookies auswählen.

Имя Borlabs Cookie
Анбитер Eigentümer dieser Веб-сайт
Цвек Speichert die Einstellungen der Besucher, die in der Cookie Box von Borlabs Cookie ausgewählt wurden.
Имя файла cookie Борлабс-печенье
Cookie Laufzeit 1 Яр
Имя WPML
Анбитер Eigentümer dieser Веб-сайт
Цвек Speichert die aktuelle Sprache.
Имя файла cookie _icl_ *, wpml_ *, wp-wpml_ *
Cookie Laufzeit 1 Тег

Низкомолекулярный ингибитор OGG1 блокирует репарацию окислительных повреждений ДНК на теломерах и усиливает противораковые эффекты метотрексата

Культура клеток и лечение

Клетки U2OS и BJ-TERT культивировали в среде Игла, модифицированной Дульбекко (DMEM; Lonza или Gibco), в то время как NTUB1 и HCT116 культивировали в среде RPMI 1640 (Gibco) и McCoy’s 5A Medium (Gibco), соответственно.Во все клеточные линии добавляли 10% фетальной бычьей сыворотки (Biowest) и 100 Ед / мл пенициллин-стрептомицин (Gibco) и выращивали при 37 ° C в атмосфере 5% CO 2 . Клеточная линия остеосаркомы человека U2OS была получена от коммерческого поставщика American Type Culture Collection (ATCC). Клетки карциномы толстой кишки человека HCT116 были получены от доктора Берта Фогельштейна (Johns Hopkins, Baltimore, MD). Клетки карциномы мочевого пузыря человека NTUB1 были получены от доктора Т.С. Ли (Academia Sinica Taiwandisabled, Nankang, Тайвань).Клеточные линии BJ-Tert были предоставлены доктором W. Hahn (Институт рака Дана-Фарбер).

Чтобы вызвать окислительное повреждение ДНК, клетки с примерно 80% слияния обрабатывали H 2 O 2 (Sigma) в концентрации 200 мкМ в бессывороточной среде DMEM в течение указанных периодов. Для выполнения ингибирования OGG1 клетки высвобождали в свежую среду, содержащую TH5487 23 или ДМСО (Sigma) в течение указанного времени и в указанных концентрациях. После обработки клеткам давали возможность восстановиться в полной ростовой среде в течение 1 ч, если упомянуто.Различные клеточные линии, используемые для каждого эксперимента, подробно описаны в дополнительной таблице S1. Аутентификация клеточной линии выполнялась с помощью профилирования с короткими тандемными повторами (STR), а тестирование на микоплазмы выполнялось регулярно.

Конструирование плазмиды OGG1-GFP и трансфекция

Вектор OGG1-GFP был создан согласно протоколу, описанному у Visnes et al. 23 . Клетки U2OS трансфицировали вектором с использованием jetPEI (Polyplus) и отбирали с помощью 1 мкг / мл пуромицина в течение 10 дней.За этим последовала клональная экспансия для создания единственного клона клеток U2OS, конститутивно экспрессирующих OGG1-GFP, и, таким образом, вариабельность уровней экспрессии была сведена к минимуму.

CRISPR / Cas9, нокаут OGG1

sgRNA были сконструированы с использованием Benchling CRISPR sgRNA Design tool (http://www.benchling.com). Специфическая sgRNA была протестирована против гена OGG1 , а также был использован нецелевой (NT) контроль (sgOGG1 # 1: GTGTACTAGCGGATCAAGTA и sgNT: CCGCGCCGTTAGGGAACGAG). Эти последовательности были клонированы в вектор lentiCRISPRv2 (плазмида Addgene # 52961) и подтверждены секвенированием по Сэнгеру.

Вирусы были получены путем временной плазмидной трансфекции в 293 Т-клетки кальций-фосфатным методом, как описано ранее 57 . Вкратце, клетки высевали при 1,1 × 10 7 клеток / чашку в 15-см чашки за день до трансфекции. Клетки U2OS OGG1-GFP трансфицировали с использованием упаковывающих плазмид второго поколения (psPAX2 и pMD.2G, Addgene # 12260 и # 12259, соответственно) и соответствующей плазмиды для переноса (pLV CRISPR sgOGG1 или sgNT). Среду собирали через 48 ч, очищали низкоскоростным центрифугированием и фильтровали через 0.Фильтры из ПВДФ (поливинилидендифторида) с размером пор 45 мкм (Millipore). Были рассчитаны титры вирусов, и значения варьировались от 10 7 до 10 8 МЕ / мл. Для проведения трансдукции клетки разделяли и через 24 часа трансдуцировали с использованием множественности инфицирования (MOI) 5, чтобы гарантировать высокую скорость трансдуцированных клеток. Клетки инкубировали при 37 ° C в течение 12 ч, и вирусный супернатант заменяли свежей клеточной средой. Был проведен этап сортировки GFP-отрицательных клеток, чтобы окончательно получить пул клеток, в котором нокаут OGG1 был подтвержден иммуноблоттингом и IF (дальнейший подробный протокол).

IF-микроскопия и анализ изображений

Клетки U2OS высевали в 12-луночный планшет на 24 ч до начала указанных обработок, после чего следовали протоколу IF. Перед фиксацией клетки предварительно экстрагировали 0,2% Triton X-100 в PBS (фосфатно-солевой буфер; Sigma) в течение 2 мин (предварительная экстракция). Клетки фиксировали 4% параформальдегидом (PFA; Agar Scientific) в течение 10 мин. После промывки PBS (Sigma) проводили пермеабилизацию клеток с помощью 0,5% Triton X-100 (Sigma) в PBS в течение 15 мин.За блокированием 3% бычьим сывороточным альбумином (BSA; Sigma) в PBS в течение 1 ч следовало окрашивание первичными и вторичными антителами и 0,5 мкг / мл 4 ‘, 6-диамидино-2-фенилиндола дигидрохлоридом (DAPI; Sigma). После каждого окрашивания этап промывки трижды (каждый раз по 10 мин в PBS). В качестве первичных использованных антител были мышиные анти-TRF2 (ab13579, Abcam) при 1/200, с анти-кроличьими анти-γh3AX (2577S; Cell Signaling), анти-53BP1 (ab36823, Abcam) при 1/1000, анти-XRCC1 (ab134056; Abcam. ) при 1/200. Вторичные антитела: против Alexa 555 мыши (ThermoFisher Scientific), против Alexa 647 кролика (ThermoFisher Scientific).Все этапы выполнялись при комнатной температуре. Получение изображений осуществляли с помощью конфокального микроскопа Leica SP5 с линзой ACS APO 40,0 × 1,15 OIL. Обработка изображений проводилась с помощью программного обеспечения Leica и ImageJ, а анализ выполнялся с помощью программного обеспечения CellProfiler. Для анализа мы оценили среднюю интенсивность сигнала в теломерах для OGG1-GFP и XRCC1, как описано ранее 16 (активация BER на теломерах). Для маркеров повреждения ДНК γh3AX и 53BP1 мы измерили индекс перекрытия с маркером теломер TRF2.Наконец, частота микроядер была рассчитана с использованием программного обеспечения CellProfiler. Все эксперименты проводились не менее 2 раз независимо друг от друга. Данные доступны.

Флуоресценция теломер in situ гибридизация (Telo-FISH)

Клетки обрабатывали 0,2 мкг / мл колцемида (Life Technologies) в течение 4 часов для обогащения клеток в метафазе. Осадки клеток подвергали гипотонической обработке 75 мМ раствором KCl, фиксировали в холодном растворе Карнуа [метанол: уксусная кислота (3: 1)] и наносили на предметные стекла.Образцы снова фиксировали в PBS, содержащем 3,7% PFA, и дегидратировали путем последовательных инкубаций в 70, 80 и 100% этаноле перед гибридизацией FISH. ДНК денатурировали при 72 ° C в 1 M HCl, 20-кратном солевом растворе цитрата натрия (SSC) и смеси для гибридизации с деионизированным формамидом и гибридизовали с теломерным зондом, меченным Cy3 (CCCTAA) 3 пептид-нуклеиновая кислота (PNA) (0,5 мкг / мл) [Panagene, PNA BIO / F1001 (TelC-FAM)]. Наконец, слайды промывали буфером, содержащим такой же высокий процент формамида, чтобы удалить неспецифически связанный зонд, и ДНК окрашивали 0.5 мкг / мл раствор DAPI / Antifade (Palex Medical). Изображения Telo-FISH получали в цифровом виде с помощью камеры CCD (Photometrics SenSys), подключенной к микроскопу Leica DM5500B, с использованием объектива 100 × и с использованием программного обеспечения CytoVision 7.2. Изображения были проанализированы вслепую, чтобы оценить хромосомный мульти-теломерный сигнал или свободные от сигнала концы.

Сортировка клеток

Клетки U2OS обрабатывали трипсином, ресуспендировали при концентрации 5 × 10 6 клеток / мл и инкубировали с 5 мкг / мл Hoechst в течение 15 минут при 37 ° C в темноте.Клетки сортировали по количеству ДНК, определяя три области для сортировки: фазы G1, S и G2 / M. Проверка чистоты после сортировки использовалась для подтверждения чистоты полученных отсортированных популяций, которая была выше 90% во всех случаях (дополнительный рисунок S1A). Сортировку проводили с использованием BD Influx (BD Biosciences). Отделенные клетки (не менее 1 × 10 6 клеток из каждой отсортированной популяции) собирали в пробирки, содержащие 0,5 мл культуральной среды, и после центрифугирования осадок клеток хранили при -20 ° C до использования для экстракции ДНК или белка.

Анализ образования колоний

Подсчитывали

клеток U2OS (OGG1-GFP или OGG1-KO) с ДМСО или с указанной концентрацией TH5487 и высевали на чашки Петри 10 см (500 клеток на чашку) и инкубировали до тех пор, пока размер колоний не превысил минимальный 50 ячеек (6 дней). Затем среду удаляли, и клетки заражали одним импульсом OS H 2 O 2 (Sigma) при 200 мкМ в бессывороточной среде DMEM в течение 1 ч). Затем обработку удаляли, и клетки высевали в полную среду в присутствии или в отсутствие TH5487 (10 мкМ) в течение 6 дополнительных дней.Наконец, клетки дважды промывали PBS, фиксировали ледяным метанолом (Sigma) в течение 5 минут и окрашивали 1% раствором кристаллического фиолетового (Sigma) в течение 30 минут. После тщательной промывки в водопроводной воде и сушки на воздухе. Планшеты сканировали и измеряли относительную площадь колоний с помощью программного обеспечения ImageJ. Этот эксперимент проводился один раз. Данные доступны.

Экстракция ДНК, очистка человеческого OGG1 и относительное количественное определение окисленных оснований в конкретных областях генома с помощью количественной ПЦР (кПЦР)

ДНК

экстрагировали из культивируемых клеток с помощью набора Flexigene DNA Kit (Qiagen) в соответствии с инструкциями производителя и количественно определяли флуорометрическим анализатором PicoGreen. анализ (Thermo Fisher Scientific).

Мы адаптировали ранее описанный протокол окисления теломер 27 для количественной оценки относительного накопления окисленных оснований в определенных областях генома путем инкубации ДНК с белком hOGG1, который был ранее очищен, как сообщалось ранее 23 . Это метод кПЦР, который основан на различиях в кинетике ПЦР между матричной ДНК, расщепленной OGG1, и непереваренной ДНК. Этот фермент распознает и разрезает 8-oxoG, создавая базовые сайты, которые превращаются в SSB за счет его активности AP-лиазы.Эти SSB ингибируют ПЦР, таким образом, ΔCt после переваривания ДНК OGG1 (переваренная Ct – непереваренная Ct) пропорциональна окислительному повреждению в амплифицированной области (дополнительный рисунок S1B). Условия, используемые для инкубации: 2,4 мкМ hOGG1 в течение 4 ч в буфере для ДНК-гликозилазы (25 мМ Трис-HCl, 15 мМ NaCl, 2 мМ MgCl 2 , 0,0025% Твин-20 при pH = 8). Реакцию останавливали инкубированием при 95 ° C в течение 5 минут. Анализ qPCR проводили на 40 нг расщепленной или непереваренной геномной ДНК с использованием тех же реагентов, праймеров и условий, которые описаны в исходном протоколе 27 .Каждую количественную ПЦР выполняли в трех экземплярах, включая контроли без шаблона, в системе для ПЦР в реальном времени Abi QuantStudio 6 Flex (Applied Biosystems). Используемые праймеры перечислены в дополнительной таблице S2. Шесть независимых экспериментов были включены для каждого условия и проанализированы в трех повторностях. Данные доступны.

Экстракция белка, количественное определение и иммуноблоттинг

Экспрессия белка определялась иммуноблоттингом. Вкратце, осадок клеток готовили в буфере для анализа радиоиммунопреципитации (RIPA) (Sigma) в присутствии смеси ингибиторов протеазы (Roche).Концентрацию общего белка определяли с использованием набора Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) в соответствии с инструкциями производителя. Сорок микрограммов белка подвергали электрофорезу с помощью электрофореза в 12% додецилсульфат натрия в полиакриламидном геле (SDS-PAGE) и переносили на мембраны Immobilon-FL (Millipore). Мембраны блокировали трис-забуференным физиологическим раствором с Твин-20 (TBS-T; 50 мМ Трис / HCl, 150 мМ NaCl, pH 7,5 плюс 0,2% Твин-20) и 5% обезжиренным молоком в течение 1 ч при комнатной температуре.Блоты зондировали следующими первичными антителами: кроличьи анти-OGG1 (ab124741, Abcam) в разведении 1/2500 и мышиные анти-β-актин (A5441; Sigma) в разведении 1/10 000 в TBS-T, содержащем 5% не- жирное молоко. В качестве вторичных антител использовали антитела против мышиного и кроличьего IgG-HRP (иммуноглобулин G пероксидаза хрена; Dako), и иммуноблоты получали с использованием субстрата Immobilon Classico Western HRP (Millipore). Каждый иммуноблот выполнялся в трех экземплярах. Изображения были проанализированы с использованием программного обеспечения ImageJ (NIH Image), и уровень белка OGG1 был нормализован по уровням актина.Полноразмерные блоты представлены на дополнительном рисунке S2.

Обнаружение внутриклеточных ROS во время фаз клеточного цикла с помощью проточной цитометрии

Генерация внутриклеточных ROS во время клеточного цикла определялась с использованием флуоресцентного зонда 2 ‘, 7’-дихлородигидрофлуоресцеина диацетата (h3DCFDA; Molecular Probes) в сочетании с окрашиванием по Хёхсту для обнаружения Содержание ДНК. Нефлуоресцентный h3DCFDA пассивно диффундирует в клетки и превращается в высоко флуоресцентный 2 ‘, 7’-дихлорфлуоресцеин (DCF) при окислении ROS.Клетки собирали с использованием трипсина (1 ×) в течение 5 минут, осаждали и ресуспендировали в PBS, содержащем Hoechst (1 мкг / мл), в течение 15 минут. Затем клетки промывали PBS и осаждали центрифугированием. Затем осадки ресуспендировали в RPMI без h3DCFDA, содержащего сыворотку, до конечной концентрации 10 мкМ, клетки инкубировали в течение 30 минут при 37 ° C и анализировали проточной цитометрией (Navios, Beckman Coulter) с использованием FL1 (525/540 нм). или каналы FL9 (450/460 нм). Мы использовали медианное значение интенсивности h3DCFDA в качестве порога для стратификации отрицательных (ниже медианы) или положительных (выше медианы) клеток.Затем был рассчитан процент ROS-положительных клеток в фазах G1, S или G2M. Этот эксперимент проводился два независимых раза. Данные доступны.

Иммунопреципитация хроматина (ChIP)

ChIP выполняли, как сообщалось ранее 58 в родительских клетках U2OS или клетках U2OS OGG1-GFP. Хроматинизированную фракцию белка OGG1-GFP обогащали с использованием GFP-ловушки для иммунопреципитации (Chromotek). ДНК, связанную с OGG1-GFP, нагревали до обратного сшивания. Очищенную ДНК OGG1-GFP амплифицировали с помощью ПЦР как теломерную последовательность, так и однокопийный ген 36B4 с использованием специфических праймеров (дополнительная таблица S2).Обогащение OGG1-GFP на теломерах или 36 B4, нормализованное к входу 10%, использовали для расчета относительного обогащения OGG1 для 2 областей в клетках U2OS-GFP по сравнению с родительскими клетками U2OS. Этот эксперимент проводился 2 раза. Данные доступны.

Взаимодействие с мишенью OGG1

Для подготовки образцов клетки инкубировали с 20 мкМ TH5487 в течение 2 часов при 37 ° C, а затем помещали в течение 3 минут при двенадцати различных температурах в диапазоне от 37 до 62 ° C. После добавления буфера для лизиса [50 мМ Трис – HCl pH 7.5, 150 мМ NaCl, 1 мМ этилендиаминтетрауксусной кислоты (ЭДТА), 1% NP-40, 0,5% дезоксихолата натрия и 0,1% SDS с добавлением полного коктейля ингибиторов протеазы (Roche)], происходил лизис клеток путем замораживания-оттаивания. В следующем центрифугировании (30 мин при 17000 г при 4 ° C) было выполнено и 70 мкл супернатанта смешали с 23 мкл загрузочного красителя перед тем, как образцы нагревали при 95 ° C в течение 10 мин. Далее были выполнены SDS-PAGE и WB. Мембрану блокировали 5% обезжиренным молоком в течение 1 ч при комнатной температуре.В качестве первичных антител использовали кроличьи анти-OGG1 (ab124741, Abcam) 1: 1000 и мышиные анти-актин (ab6276, Abcam) 1: 5000. Этот эксперимент был проведен один раз на клетках U2OS (родительских) и один раз на клетках U2OS OGG1-GFP (не показаны). Данные доступны.

Синергетические эксперименты

Комбинации лекарств были созданы и распределены с использованием цифрового дозатора D300e (Tecan) в 96- или 384-луночных планшетах. Клетки высевали в 96- или 384-луночные планшеты, содержащие комбинации лекарств, с использованием Multidrop Combi Reagent Dispenser (ThermoFisher Scientific).Затем клетки инкубировали 3 дня при 37 ° C. Резазурин (R7017, Sigma) добавляли до конечной концентрации резазурина 0,01 мг / мл и измеряли флуоресценцию при ex530 / em590 после инкубации в течение 6 часов в считывающем устройстве для микропланшетов Hidex Sense (Hidex). Z-балл лекарственной синергии был рассчитан и интерпретирован с помощью Synergy Finder (http://synergyfinder.fimm.fi).

Был начат предварительный скрининг синергии в клетках U2OS, BJ-TERT, NTUB1 и HCT116 на TH5487 с традиционными химиотерапевтическими препаратами (цисплатин, 5-флуорацил, доксорубицин, метотрексат) или ингибиторами BER (олапариб, APE1i) для выбора кандидатов.Этот первоначальный отбор проводился один раз. Для лучших кандидатов синергизм метотрексата и доксорубицина был повторен три независимых раза в четырех независимых клеточных линиях (U2OS, BJ-TERT, HCT116 и NTUB1).

Статистический анализ

Тест Колмогорова – Смирнова использовался для оценки того, были ли наборы данных распределены нормально. Для сравнительного анализа статистически значимые различия оценивались с помощью непарного t-критерия для нормальных распределений и U-критерия Манна – Уитни для ненормальных распределений.Статистические расчеты и графики были выполнены с использованием программного пакета SPSS версии 19.0 (IBM) и GraphPad Prism 8 (GraphPad Software Inc).

Как заменить пороги в автомобиле ВАЗ 2110

Пороги — самое уязвимое место в автомобиле. Коррозия считает их своего рода «лакомством». В первой десятке, которой едва исполнилось 8-9 лет, можно наблюдать жуткие ржавые следы, которые часто переходят в сквозные дыры. Причем под слоем краски они могут быть даже не видны, порог просто гниет изнутри.

Вам понадобится

  • — болгарка;
  • — сварочный аппарат;
  • — новые пороги;
  • — грунтовка;
  • — мастика;
  • — щетки по металлу;
  • — колеса для болгарки;
  • — набор отверток и ключей.

Инструкция по эксплуатации

1

Заменить пороги на ВАЗ-2110 в том случае, если они утратили первоначальный вид и не могут обеспечить выполнение всех возложенных на них функций.К сожалению, именно на эту часть тела приходится большая часть воды и химикатов с дорог. Поэтому сначала гниют пороги. И как бы вы ни старались остановить коррозию, вряд ли это удастся. Если начался гниение, его нельзя предотвратить никакими антикоррозийными обработками. Перед тем как приступить к ремонту, подготовьте автомобиль, отключите аккумулятор и снимите его, ведь сварка будет проводиться.

2

Продолжить подготовку, для этого нужно полностью разобрать ремонтируемую сторону станка.Придется снять коврики, демонтировать всю шумоизоляцию и ремни безопасности, сиденья, обе двери (если заменены оба порога, снимите все). Также избавьтесь от пластиковых декоративных панелей, рундука, заднего колеса и переднего крыла. Другими словами, перед вами должен быть голый металл, никакой пластик и другие горючие материалы, мешающие работе.

3

Уплотнить все стекла изнутри, чтобы при работе с болгаркой на них не оседала пыль. Также не лишним будет укрыть остальную часть автомобиля.Подбирайте болгарку и приступайте к зачистке. Всю гниль, находящуюся внизу станка, необходимо срезать. Часть нижней части разъема идет под нож и весь порог автомобиля. Если верхняя часть разъема в плачевном состоянии, то ее тоже необходимо разрезать. Завершающий этап подготовительных работ включает зачистку металла щеткой.

4

Берем сварочный аппарат и, предварительно отрегулировав силу тока, привариваем разъем. К новому порогу необходимо приварить усилитель, после чего необходимо смазать все изнутри специальной мастикой, которая защитит от коррозии.После этого сваривать можно только соединителем. Все сварные швы необходимо зачистить шпателем.

5

Приварите порог к кузову, сделайте это максимально аккуратно, чтобы шов был ровным и прочным. При необходимости можно выложить заплатки. Только проследите, чтобы его толщина была такой же, как у металла, из которого изготовлен порог. В конце снова зачищаются все швы, а металлические детали обильно смазываются мастикой. Со стороны салона необходимо сначала уложить мастику, потом полиэтилен, потом снова мастику и только потом нужно уложить шумоизоляцию и ковролин.Снаружи новый порог необходимо покрыть несколькими слоями грунтовки и при желании покрасить в желаемый цвет.

примечание

При работе обязательно используйте очки, перчатки и в некоторых случаях респираторы. Всегда держите под рукой несколько ведер с водой, так как существует высокий риск возгорания.

Подробнее о замене порогов на десятку

Prreal Lip Gloss Animer и пересмотренная цена Базовый набор Colourful Moisturizing B 8Pcs

Prreal Lip Gloss Animer и пересмотренная цена Base Set Colourful Moisturizing B 8Pcs

Set, 8Pcs, / mangyan149923.html, B, Colourful, $ 16, Lip, Gloss, ikigaipr.sebastiancanori.com.ar, Moisturizing, Base, Prreal, Make-up, Lips, Lip Glos, Lip, Gloss $ 16 Prreal Lip Gloss Base Set, 8Pcs Colourful Moisturizing Lip Gloss B Make-up Lips Lip Glosses Prreal Lip Gloss Animer и пересмотренная цена Базовый набор Colorful Moisturizing B 8Pcs Базовый набор Prreal Lip Gloss за 16 $, 8Pcs Красочный увлажняющий блеск для губ B Make-up Lips Lip Glosses Set, 8Pcs, / mangyan149923.html, B, Colourful, $ 16, Lip, Gloss, ikigaipr.sebastiancanori.com.ar, Увлажнение, База, Prreal, Макияж, Губы, Блески для губ, Lip, Gloss Prreal Lip Gloss Animer и пересмотр цен Базовый набор Colorful Moisturizing B 8Pcs

$ 16

Базовый набор блеска для губ Prreal, 8 цветных увлажняющих блесков для губ B

  • 【Сделай сам】: жидкий пигмент для блеска для губ, улучшенный формулой с высокой концентрацией, может обеспечить глубину и яркость.Вы можете использовать только 8 видов косметических жидких красок или смешивать их, чтобы настроить более яркие цвета или создать удивительные эффекты наслоения, предоставляя неограниченные возможности для вашей глазури для губ своими руками!
  • Безопасный】: Изготовлен из натуральных растительных маслянистых цветных пигментов, нетоксичен и безопасен для вашего здоровья. Он не раздражает кожу, его можно наносить прямо на губы или использовать для придания губам пухлости и сияния. В набор входят: 8 базовых кремов для увлажняющих блесков для губ. Цвет: красный, черный, белый, темно-желтый, темно-красный, коричневый, оранжевый, ярко-красный.
  • 【Набор «Префект»】 8 уникальных цветов, каждый цвет запечатан и независимая упаковка, гарантирующая отсутствие переполнения, беспорядка и отходов. Удовлетворите все ваши потребности в создании ярких и красивых поделок, которые вы хотите! Вы их полюбите!
  • 【Простота в использовании】: этот краситель может быть быстро интегрирован и прикреплен к вашей работе как новичкам, так и профессионалам, детям или взрослым. Он может долго сохранять свою яркость без обесцвечивания, и из него легко сделать идеальный продукт.
  • 【Многократное применение】: отлично подходит для блеска для губ, глазури для губ, пухлых губ, средства для увеличения губ и различных масел, лосьонов, блеска для губ и гелевых составов.Помогает увлажнить и придает губам ощущение мягкости и гладкости.
|||

Базовый набор блеска для губ Prreal, 8 цветных увлажняющих блесков для губ B

Мы используем файлы cookie, чтобы вам было удобнее. В соответствии с новой директивой о конфиденциальности электронной почты нам необходимо запросить ваше согласие на установку файлов cookie. Учить больше.

Разрешить файлы cookie

Наш интернет-магазин на сайте MainlandAggregates.co.uk — это простой способ просмотреть и сравнить информацию о продуктах и ​​получить очень конкурентоспособные расценки для вашего проекта.Мы специализируемся на поставке и поставке всех типов карьерных, переработанных и декоративных заполнителей, а также специальных покрытий для верховой езды и дров, поставляемых навалом или насыпью. Наш ассортимент включает в себя все типы и сорта переработанных, добытых в карьерах и декоративных заполнителей, таких как щебень, дорожные дорожные покрытия / скальпирование, кирпичные биты, строительный песок, обычный гравий, декоративный гравий, DOT Type 1 (MOT), балласт для железнодорожных путей, конный кремнезем. песок, резиновая крошка для верховой езды, габион, каменная крошка, экранированный верхний слой почвы, геотекстильные мембраны, компост, щепа, каменная соль, щебень / гравий из валлийского сланца и многое другое!….

Рекомендуемые товары

Котсуолдский самовязывающийся гравий

Замена порогов на ВАЗ 2110 и 2112. Когда пришло время

Довольно часто возникает необходимость замены порогов на ВАЗ 2110 и 2112. Этот элемент кузова сильно подвержен коррозии, поэтому нет ничего удивительного в регулярности этой работы. Качество оборудования у этой модели не очень высокое. Также большое количество реагентов, которые активно взаимодействуют с металлом и вызывают его коррозионные повреждения, негативно сказываются на его состоянии.Многие владельцы «десятки» предпочитают производить замену самостоятельно, что позволяет существенно сэкономить при обслуживании автомобиля. Тем более, что у вас не должно возникнуть трудностей с этой работой.


Инструменты


Замена порогов на ВАЗ 2110 и 2112 , требует достаточно внимательного подхода к себе. Для успешного ремонта нужно правильно выбрать инструменты. Для этого вам потребуются:
  • Диск шлифовальный — 3 шт .;
  • Корсет для болгарки.Выбирая, убедитесь, что он хорошо гофрирован и достаточно жесткий;
  • Диск зачистной — 2 шт .;
  • Мастика;
  • 2 щетки;
  • Грунтовка;
  • Разбавитель 646.
Вам обязательно понадобятся сварочный аппарат (полуавтомат), болгарка и дрель. Не забудьте запастись классическим автомобильным набором инструментов.

Детали … Конечно, нужны пороги. Кроме них потребуется приобрести от ВАЗ 2108 одну из сторон днища, это железо пойдет на заплатки.Также вам может понадобиться ремонтный комплект переднего крыла.


Подготовка


Автомобиль необходимо должным образом подготовить к ремонту. Обязательно отсоедините аккумулятор. Снимите рундук со стороны ремонта. Демонтировать правое крыло. Для дополнительного удобства двери можно снять. Но это необязательно. Убираются сиденья, коврики, пластиковые накладки. Если есть звукоизоляция, то ее тоже лучше удалить.

Вырезан старый порог. Обратите внимание на состояние утюга около порога.Отрежьте все гнилые кусочки до «здорового» металла. Края оставшегося металла зачищаем щеткой до чистого железа. В этом случае обязательно закройте стекло в машине картоном. Окалина может серьезно повредить их.

Ремонт


Выполнив все предварительные действия, можно переходить к основным работам. Помните, что сварка пожароопасна, приготовьте несколько ведер воды. Все это делается в следующем порядке:
  • Очищаем место сварки болгаркой.Привариваем коннектор;
  • К порогу приварен усилитель. После этого необходимо промазать получившуюся конструкцию мастикой;
  • Новый порог приварен к разъему;
  • С помощью кельмы тщательно зачищаем поверхность швов;
  • На пороге есть специальный изгиб. Так прикатил к разъему. Это сделает порог более прочным;
  • На все оставшиеся дырочки накладываем заплатки. Их следует аккуратно приварить к корпусу.Дно от ВАЗ 2108 отлично подходит для лоскутков, нарезано на нужные части;
  • Опять все очищено и покрыто мастикой;
  • Далее нужно прогрунтовать место ремонта. Раскрасьте это.
Все остальные детали, снятые во время подготовки, устанавливаются обратно. При необходимости проводят ремонтные работы с другой стороны.


Лечение


Чтобы продлить жизнь частям тела, их нужно своевременно лечить.Учтите, что образование ржавчины не остановит ее. Поэтому проделайте все необходимые действия заранее, не дожидаясь, пока тело «зацветет». Опытные автолюбители проводят эту процедуру после каждой зимы. Это значительно снижает стоимость кузовного ремонта.

Обычно весь процесс выглядит так:

  • Осмотрите днище автомобиля. Все участки с поврежденным защитным покрытием очищаются. Сначала снимите краску и антикоррозийную защиту. Затем до блеска зачищаются наждачной бумагой;
  • Обработаны антикоррозийным составом.Производитель рекомендует использовать для этого «». Но многие автомобилисты успешно заменяют его «пушечным жиром». Это вещество отлично противостоит всем возникающим на дороге трудностям.

Добавить комментарий

Ваш адрес email не будет опубликован.